ID: 924029183

View in Genome Browser
Species Human (GRCh38)
Location 1:239869296-239869318
Sequence CTTGAGCCCTAAAATGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924029183 Original CRISPR CTTGAGCCCTAAAATGATGA AGG Intronic
901597024 1:10393361-10393383 ATGGAGCACTAGAATGATGAAGG + Intergenic
905252082 1:36655957-36655979 CCTGGCCTCTAAAATGATGAGGG - Intergenic
908492722 1:64662467-64662489 CTTGAGGCCTAAGAAGATGGGGG - Intronic
908682087 1:66673675-66673697 GTTGACACCTCAAATGATGATGG - Intronic
909498071 1:76302034-76302056 TTTGTTCCCTAGAATGATGATGG + Intronic
910234519 1:85021952-85021974 ATTCAGCCTTAAAATGTTGAAGG - Intronic
911505239 1:98740987-98741009 TTGGAGCCCTTAAATGATCAGGG + Intronic
916178145 1:162060132-162060154 CTTGGGCCAGAAAATGATGAGGG - Intergenic
918387255 1:184022051-184022073 TTTGAGCCCTAAGACGATAAGGG - Intronic
920732711 1:208502994-208503016 CTTTATGCCTAAAATGAAGATGG + Intergenic
924029183 1:239869296-239869318 CTTGAGCCCTAAAATGATGAAGG + Intronic
1063353576 10:5377577-5377599 CTTCAGACCTCAAATGATGTAGG - Intergenic
1064224992 10:13474679-13474701 CCTGAGCCCAACACTGATGACGG - Intronic
1066824302 10:39545528-39545550 CTTGAGGCCTATAGTGATAAAGG + Intergenic
1068614642 10:59099809-59099831 CTTTGGCCATAAAATGAGGATGG - Intergenic
1076304464 10:129454771-129454793 CTTGAGCCCAAGAAGGATGTGGG - Intergenic
1079016026 11:16869445-16869467 CTTCATCTCTAAAATGGTGATGG + Intronic
1080577488 11:33613483-33613505 CTTGAGGCCTAAGAAGATGCTGG - Intronic
1080886783 11:36375325-36375347 CAGAAGCCCTAGAATGATGAAGG - Intronic
1081976386 11:47238008-47238030 CTTGGGTCCTCAAATAATGATGG + Intronic
1084724156 11:70929523-70929545 CATGAGCCCAAAAATGCAGATGG - Intronic
1086003176 11:82003902-82003924 CATGAGCCCCCAAATGATGCAGG + Intergenic
1086822304 11:91448797-91448819 CCTGAACCCTAAAATGTTAAAGG + Intergenic
1087824884 11:102753849-102753871 TTTGATCCTTAAAATGATAAAGG + Intergenic
1090489379 11:127144740-127144762 CTTGAGTGATAAAATGATGGAGG + Intergenic
1093786221 12:23194849-23194871 ATTTGGCCCTAAAATGAGGATGG + Intergenic
1095078401 12:37964212-37964234 ATTGAGCCCTAAGATGAAAAAGG + Intergenic
1097941259 12:65308762-65308784 CTTGGGCCCTAATTTGAAGACGG + Intronic
1097945921 12:65367281-65367303 CTGGAGCACTTATATGATGAAGG + Intronic
1097988562 12:65810045-65810067 CTTAAGCCCTAGAGTGATAATGG + Intergenic
1099468746 12:83020235-83020257 GTTGAGCCCTAGAATGAAAATGG - Intronic
1100464793 12:94835258-94835280 CTTGAGCCATAAAATTTTGCTGG - Intergenic
1102796187 12:115690801-115690823 TTTGAGCCCTAAATTAGTGAAGG - Intergenic
1104083759 12:125456555-125456577 CTTCAGCCCTAAAGGGAAGAGGG + Intronic
1104287011 12:127432714-127432736 CTTCAGCCCTAAAGGGAAGAGGG - Intergenic
1105396885 13:20044354-20044376 CTTGACCCCTAATATGCTGAGGG - Intronic
1105641671 13:22271171-22271193 CTTGAGCCCCAAGATGACTATGG + Intergenic
1105807506 13:23964248-23964270 CCTAACCCCTAATATGATGATGG + Intergenic
1107123953 13:36824356-36824378 GTTGAGGCCTAAAATGTTTAGGG + Intronic
1108085089 13:46779832-46779854 CTAGAGCCCTAACATGAGCAGGG + Intronic
1110161132 13:72379947-72379969 CCTGAGCCCTTGAAGGATGAGGG - Intergenic
1115361952 14:32513452-32513474 ATAGAGCCCTAAAAGAATGAGGG + Intronic
1119243262 14:73080659-73080681 CTTGAGGCCTAAACTGTTAAAGG + Intronic
1120035099 14:79687584-79687606 CTTGAGCCCTGAAATAAAGGAGG - Intronic
1120712579 14:87808020-87808042 CTAGAGCCCAGAAAGGATGAAGG - Intergenic
1120868324 14:89315152-89315174 TTTGTGCCCTAGAATGATGCTGG - Intronic
1121071050 14:91021716-91021738 CTTGTGCATTAAAATGATTAGGG - Intronic
1121620618 14:95345588-95345610 CTTGATGGCTAAAATGATGATGG - Intergenic
1122002533 14:98672268-98672290 CTGGGACCCTAAAAGGATGAGGG - Intergenic
1123937265 15:25200004-25200026 CTGGAGCCCTGCAGTGATGACGG + Intergenic
1127024676 15:54790910-54790932 TTTGATCCTTAACATGATGATGG - Intergenic
1127265546 15:57358172-57358194 TTTGAGCAATAAAATAATGATGG + Intergenic
1127345122 15:58087522-58087544 ATTTAGCCATAAAAAGATGAAGG + Intronic
1130446975 15:84012343-84012365 CTTCAGTTCTAAAATGATAAGGG - Intronic
1130555229 15:84918039-84918061 GTGGAGCACCAAAATGATGAGGG + Intronic
1131767162 15:95690683-95690705 CCTGAGGACTAAAATGATGTTGG + Intergenic
1136919635 16:34254289-34254311 ATTGAGCCCTACAATGAAAAAGG + Intergenic
1137584279 16:49654675-49654697 GCTGCGCCCTAAAATGATCACGG - Intronic
1138221223 16:55252181-55252203 ATTGAGTCCTAAAACAATGAAGG + Intergenic
1139897510 16:70299364-70299386 CTTCAGCCCTAAAAGGGTCAGGG + Intronic
1143246292 17:5488259-5488281 CATGAGGCCTAAAATGAATAAGG + Exonic
1143439304 17:6956110-6956132 CTTCATCCATAAAATGAGGATGG + Intronic
1145417002 17:22724269-22724291 CTTGAGGCCTAAGATGAAAAAGG + Intergenic
1146140727 17:30365803-30365825 CTTAAGCACTAAAAAGATGAGGG - Intergenic
1151060469 17:71086622-71086644 CTGATGCCCTAAAATGATTAAGG - Intergenic
1151334023 17:73429734-73429756 CTTGAGCTCCAGAATGCTGAGGG - Intronic
1154237042 18:12615796-12615818 CTTGATTCCTAAAATGTTAAAGG + Intronic
1156257230 18:35409916-35409938 CCTGAGCCTTTATATGATGAAGG - Intergenic
1157887197 18:51380281-51380303 CATGAGCCTCAAAATGATCAGGG - Intergenic
1158659576 18:59374104-59374126 GTTGAGCTTTAAAAAGATGAGGG + Intergenic
1161334319 19:3704226-3704248 CTGGAGCCTTAAAATGGTCAAGG - Intergenic
1162235389 19:9304997-9305019 CTTGTGCCCTAAAACACTGAGGG + Intronic
1164363967 19:27552745-27552767 TTTGAGCCCTAACATGAAAAAGG + Intergenic
1165344790 19:35238187-35238209 CTAGTGCCCTTAAAAGATGAGGG + Intergenic
1168569218 19:57451158-57451180 CTTGAACCCAAAAATGATGTAGG + Intronic
924967001 2:86691-86713 CTTGCGTCTTAAAATGATGTTGG + Intergenic
925869483 2:8256659-8256681 CTTGAGCCCAAAAAAGCTGGTGG + Intergenic
928205778 2:29282373-29282395 CTTCAGCTCTAAGATGAAGATGG + Intronic
929584497 2:43105305-43105327 CTTCACCCCTAAAGTGATGAAGG + Intergenic
932195001 2:69775746-69775768 TTTTAGCCTTAAAATGAGGAAGG + Intronic
934586214 2:95498935-95498957 CTTGAGTTCTAAAATGATAATGG + Intergenic
937611905 2:123871709-123871731 CTTGAGCCATCAAACGATGTTGG - Intergenic
938777157 2:134551960-134551982 CCTGAGCCCTCAAATGAGGGTGG - Intronic
941710389 2:168705659-168705681 CTTGAGGCCTAAATTGACAATGG - Intronic
941780717 2:169441591-169441613 CTGGAGAACTAAAAAGATGAAGG + Intergenic
943260716 2:185658523-185658545 ATTCAGCCATAAAATAATGAAGG - Intergenic
944105543 2:196075785-196075807 GTTGTGCCTTAAAATGAGGAAGG + Intergenic
946721055 2:222608282-222608304 CTGGAGCCCTCAAATAATGGAGG - Intronic
1170237884 20:14128051-14128073 CCTGAAACCTACAATGATGAGGG + Intronic
1170395416 20:15920696-15920718 CTTTAGCCGGCAAATGATGAAGG + Intronic
1172312370 20:33928607-33928629 CTTGAGCCCGACAAGGTTGAGGG - Intergenic
1173147387 20:40536380-40536402 CTTGAGTCCTATTATGATTAAGG - Intergenic
1173773637 20:45684953-45684975 CTTGATTCCTGAAATGATGCAGG + Exonic
1175065301 20:56279508-56279530 CTTGAGTACCAAAATGATTAAGG + Intergenic
1176342640 21:5713090-5713112 CTTGAGTCTGAAGATGATGATGG + Intergenic
1176474894 21:7145241-7145263 CTTGAGTCTGAAGATGATGATGG + Intergenic
1176502187 21:7611366-7611388 CTTGAGTCTGAAGATGATGATGG - Intergenic
1176536961 21:8111159-8111181 CTTGAGTCTGAAGATGATGATGG + Intergenic
1176900637 21:14437651-14437673 CTTGAGAACAAGAATGATGAAGG + Intergenic
1177597841 21:23268630-23268652 CTTAAGCCCTAACATGTTAATGG + Intergenic
1178597074 21:33963779-33963801 CCTGACTCCTAAAATGCTGACGG + Intergenic
1178746068 21:35251442-35251464 CTTAAGCCATAGAATGAGGATGG - Intronic
1179237696 21:39562127-39562149 CTTCATCTATAAAATGATGATGG + Intronic
1203241912 22_KI270733v1_random:27563-27585 CTTGAGTCTGAAGATGATGATGG + Intergenic
950353750 3:12384405-12384427 CTTGATTCCTAAATGGATGATGG + Intronic
954245046 3:49324732-49324754 ATTGAGCCTCAAAATGAAGATGG - Exonic
954513180 3:51146139-51146161 TTTCAGCTCTAATATGATGAAGG + Intronic
958976020 3:100668564-100668586 CCTGAGCCTTAAGTTGATGAGGG - Intronic
960288472 3:115856225-115856247 CTTAAGCCCCAAAGTGATGACGG + Intronic
962119115 3:132543418-132543440 TGTCAGCCCTAAAATGATCAAGG + Intergenic
963110407 3:141683532-141683554 CTTGAACCTTAAAATGAGGTGGG - Intergenic
965238469 3:166160022-166160044 CTTAAACCCTAAAATTATTATGG - Intergenic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
967909960 3:194534270-194534292 CTTCCTCCCTAAAATGATGCTGG - Intergenic
972343647 4:38174865-38174887 CTTGAGCTTTAAAAAGAAGAAGG + Intergenic
973999168 4:56493575-56493597 CTTGAGCCCTGACATGGTGGTGG + Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
982215194 4:153076725-153076747 CATGAGGCCTAAAATGAAAAGGG - Intergenic
985155136 4:186979648-186979670 CTTGTGTCCTGGAATGATGACGG + Intergenic
986356739 5:6936092-6936114 TATGATCCCTAAAAGGATGAAGG + Intergenic
989021961 5:37018357-37018379 TTTGAGCATTAAAATAATGATGG - Intronic
990269568 5:54121398-54121420 CTTGAGCCTGAACATGATGCTGG - Intronic
990398287 5:55407655-55407677 ATTGAGGCCAAAAATAATGAGGG - Intronic
990696917 5:58428649-58428671 GTTGACCTATAAAATGATGATGG - Intergenic
992630579 5:78676364-78676386 ATTCAGCTATAAAATGATGATGG - Intronic
992733704 5:79697692-79697714 GGTGAGCCCTGAAATGATGATGG - Intronic
993868802 5:93225464-93225486 CATGTACACTAAAATGATGAGGG + Intergenic
995446675 5:112252481-112252503 TATTAGCCCTAAAATGATGGGGG + Intronic
995954327 5:117756886-117756908 ATTTAGCACTAAAATGATGGTGG + Intergenic
996304381 5:122029844-122029866 TTTGAGCACTAAAATAATGAAGG - Intronic
1000866096 5:166516882-166516904 CTGTAGTCATAAAATGATGAAGG - Intergenic
1005966857 6:30732697-30732719 GATGAGACCTACAATGATGATGG - Intronic
1008436021 6:51477644-51477666 GTTGATCCCTAAAATAAAGACGG + Intergenic
1011379522 6:86727546-86727568 CTTGAGCACTAAGATTATTAAGG + Intergenic
1015534931 6:134258183-134258205 CTTGAGCCCAGGAATGAGGAGGG - Intronic
1016714306 6:147205402-147205424 CTAATGCCCTAAAATGATTATGG + Intronic
1020476700 7:8603531-8603553 CATGATACCCAAAATGATGAAGG - Intronic
1025576325 7:62647021-62647043 CTTGAGGCCTAAGGTGATAAAGG - Intergenic
1026197838 7:68188302-68188324 CTGGAGGCCTAAAAAGGTGAGGG + Intergenic
1029065639 7:97845148-97845170 CTTCAGCCATAAAATGGGGATGG + Intergenic
1032021090 7:128407422-128407444 CATGAGCCCAAGAATGCTGAAGG - Intronic
1039758172 8:40545208-40545230 GTTGAGCCTTAAGATGATGATGG + Intronic
1043663173 8:82772567-82772589 CTTTAGCCCAAAATAGATGATGG + Intergenic
1044159105 8:88890415-88890437 AGTGAGTCCTTAAATGATGAAGG - Intergenic
1045286251 8:100794127-100794149 CCTGAGCCCTGAAATGATCCTGG + Intergenic
1046292351 8:112179741-112179763 CTGGAGCCTTACAATCATGATGG + Intergenic
1046456272 8:114467482-114467504 CTTGAGATCTAAAATGATACAGG + Intergenic
1047905222 8:129465923-129465945 CCTGAGCAGTAAAATGATGGAGG + Intergenic
1055913662 9:81378440-81378462 CCTGTGCCCTAAAATTCTGATGG - Intergenic
1056296543 9:85198814-85198836 CCTTATCCCTAAAATGAGGATGG + Intergenic
1056403935 9:86256300-86256322 ATTGAAACCTAAAATAATGATGG - Intronic
1057592228 9:96382694-96382716 TTTGGGCTCTAAAATGTTGATGG + Intronic
1060141023 9:121210221-121210243 CCTGAGTCCTAAAGTGAAGATGG - Intronic
1203458229 Un_GL000220v1:10640-10662 CTTGAGTCTGAAGATGATGATGG + Intergenic
1196899001 X:120364997-120365019 CTTGAGCCCTAAAATCGTTTAGG + Intronic
1201611259 Y:15845430-15845452 CATGAGCCCTTAAAAAATGATGG - Intergenic