ID: 924031105

View in Genome Browser
Species Human (GRCh38)
Location 1:239886601-239886623
Sequence AGCAAACATATGGAAATCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924031105 Original CRISPR AGCAAACATATGGAAATCGA TGG (reversed) Intronic
904881614 1:33701821-33701843 CCGAAACATATGGAAATCAATGG + Intronic
906994397 1:50775686-50775708 AACGAACATATGGAAATCAGGGG + Intronic
907116991 1:51977620-51977642 AGCAAACACATGCACATCCAAGG + Intronic
907956924 1:59237907-59237929 AGCAAAAGTATGGAAATCTCTGG - Intergenic
908642109 1:66236549-66236571 ATCAAACATATGAAAGTTGAAGG - Intronic
908648974 1:66311494-66311516 AGTAAACATATTGAAAGCAAAGG - Intronic
909418969 1:75441358-75441380 TGCAAACATTTGGAAATCTGTGG - Intronic
909963462 1:81877998-81878020 AGCAAACAAATGGAAAATTATGG - Intronic
910776340 1:90879915-90879937 AGAAAACAAATAGAAATTGATGG - Intergenic
912051297 1:105531565-105531587 AGCAAAAACATAGAAATAGAAGG - Intergenic
914428850 1:147601324-147601346 AGCAAACATAGGTAAATCCCTGG + Intronic
917114663 1:171590703-171590725 AACAAACAGATGGAAATCCTAGG - Intronic
918008978 1:180568758-180568780 AGTAAACATATTGAAAATGATGG + Intergenic
919006549 1:191906794-191906816 GGCAAACATTTAGAAATTGATGG + Intergenic
924031105 1:239886601-239886623 AGCAAACATATGGAAATCGATGG - Intronic
1063093205 10:2886314-2886336 ACCAAACATATAGAAAGCAATGG + Intergenic
1069373280 10:67769037-67769059 AGGAAAAATATGGAAAGGGAAGG - Intergenic
1070513412 10:77181315-77181337 TGCACACACAGGGAAATCGATGG - Intronic
1071072225 10:81708053-81708075 AGCAAAAATATGGAATTAAATGG + Intergenic
1072816550 10:98515068-98515090 AGCAATCATATTGAACTCGCTGG + Intronic
1073573868 10:104604721-104604743 AGGAAACATAGGGAAATGGTGGG - Intergenic
1082029815 11:47595819-47595841 AGCCAACCTATGGCAATCTATGG + Intergenic
1085158933 11:74323184-74323206 AGCAAACATATTGAAGTCTGGGG + Intergenic
1090609756 11:128460311-128460333 AGCATCCATATGGAAAGCAAAGG - Exonic
1091963220 12:4717130-4717152 AGCAAAGATATAGAAATCTCAGG - Intronic
1093239171 12:16647668-16647690 AGCAGACACATGGAAACCAATGG + Intergenic
1093848167 12:24000663-24000685 AGAAAACAAATGGAAATGGCAGG + Intergenic
1096772676 12:53945979-53946001 AGTCAACATGTGGAAATCCAAGG + Exonic
1097767157 12:63539218-63539240 AGAACACATATAGAAATAGATGG - Intergenic
1098083970 12:66821345-66821367 AGCAAAAATGTGGAAAGCTATGG + Intergenic
1099144575 12:79024106-79024128 GGCAAACAGATGGAAATGCATGG + Intronic
1099881169 12:88468213-88468235 AGCAAACTTATTAAAATTGAGGG - Intergenic
1101792041 12:107936234-107936256 AGCAAACACATGGACTTGGAAGG + Intergenic
1103671837 12:122623452-122623474 AACAAGCAGATGGAAATCCATGG - Intronic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1110143996 13:72167513-72167535 AGCAAACACATGGTGATGGATGG - Intergenic
1112935614 13:104794482-104794504 ACCAAACAGAAGGAAATGGAAGG + Intergenic
1118705493 14:68476927-68476949 AGTAAACATCTGGACATGGAAGG - Intronic
1119674521 14:76543991-76544013 AGCAAGCAAACAGAAATCGAGGG - Intergenic
1120995470 14:90414971-90414993 AGCAAACTTGTGGAGATGGATGG + Intergenic
1122590052 14:102842642-102842664 AGCAAATATAAAGAAATCCAAGG + Intronic
1124381333 15:29169794-29169816 AGCAAACATCTGGAAGGAGATGG + Intronic
1127345278 15:58089554-58089576 AGAAAACATATCAAAATCTAAGG + Intronic
1127555026 15:60079466-60079488 AGCAAAGATTTGGAAATCATAGG - Intergenic
1130176334 15:81575373-81575395 AGCAAACATATAAAAGTTGAGGG - Intergenic
1131297283 15:91161106-91161128 ACCAAACATATGGAGATGGGTGG + Intronic
1131582235 15:93655554-93655576 AGAAAACCTGTGGAAATAGATGG + Intergenic
1131754578 15:95545777-95545799 AACATGCATATAGAAATCGATGG - Intergenic
1131920637 15:97324226-97324248 AGCAAACATCTGGGCATAGAAGG + Intergenic
1131925707 15:97381383-97381405 AGAAAATATATGGAAGTTGAAGG + Intergenic
1139916611 16:70432262-70432284 AGCAAACATATTTGAATTGAGGG + Intronic
1140776897 16:78257208-78257230 AGTAAACATTTGGAAAGTGAAGG + Intronic
1147807629 17:43143381-43143403 AGCAAACTCATGGAAACCGATGG + Intergenic
1150925333 17:69526584-69526606 ATGAATCATAGGGAAATCGAAGG - Exonic
1154355044 18:13618663-13618685 AGAAAACATTTGGAAATCCTAGG + Intronic
1165689022 19:37848478-37848500 AGCAAAAATATAAAAATCCAGGG + Intergenic
924981179 2:222910-222932 AGCAAACATGAGGAAATCCTTGG + Intronic
928065137 2:28156718-28156740 AGCAGACATATGGAATTTTAAGG + Intronic
928523455 2:32114557-32114579 AGCAAACATTTGTAAAACCAAGG - Intronic
929329272 2:40660217-40660239 AGAAAACATAAGGAACTTGAAGG + Intergenic
930313114 2:49767112-49767134 AGTATGCATATGGAAATAGAAGG + Intergenic
932638375 2:73413883-73413905 AGGATACATATGTAAATCAATGG - Intronic
936062110 2:109301720-109301742 AGCAAATACATGGGAATCAAAGG - Intronic
937537076 2:122902811-122902833 AGCAAACACATGAAAATCTCAGG + Intergenic
940672256 2:156685166-156685188 TGCAAACATTTGGAATTCAAGGG + Intergenic
947485722 2:230546913-230546935 AGCAAAAATATGGAATTGCAGGG + Intergenic
948245307 2:236478222-236478244 AACCAACATATGAAAATCTATGG - Intronic
948300865 2:236906142-236906164 GGCAAACAGAAGGAAATCGGAGG + Intergenic
948692620 2:239716298-239716320 AGAAAACATTTGGAAAGTGAGGG + Intergenic
1171057138 20:21918330-21918352 AGCAAAGATAAGGAAATGGCTGG + Intergenic
1172814480 20:37675400-37675422 AGAAAACATAGGGAAAAGGAGGG + Intergenic
1173399092 20:42708762-42708784 AGCAAATATATGGAAAAAGAGGG - Intronic
1179933210 21:44585658-44585680 TCCAAACATATGGAATTCAATGG - Intronic
953801752 3:46029809-46029831 AGAAGACATATGTAAATAGAAGG - Intergenic
958072609 3:88633729-88633751 GGCAAATATATGGAAATATAAGG + Intergenic
958830003 3:99074888-99074910 AGCACACCTATGGAAAACCAAGG - Intergenic
960728670 3:120699191-120699213 ATTAAACACATGGAAATGGAAGG + Intronic
965522956 3:169687007-169687029 AGGAAACAGATTGAAATCAAAGG - Intergenic
965578687 3:170244617-170244639 AGCAAACCTTTGGAGATCAATGG - Intronic
966648471 3:182272580-182272602 AGCAACCATAAGAAAATTGAAGG + Intergenic
967597138 3:191339563-191339585 AGCAATCATAGAGAAATCTAGGG + Intronic
969831220 4:9798750-9798772 AGCATAAATGTGGAAATCCAAGG + Intronic
971811454 4:31433084-31433106 GGCAAACTTAGGGAAACCGAAGG + Intergenic
972065068 4:34932518-34932540 AGAAAGCATATGGAGATAGATGG - Intergenic
973298119 4:48549737-48549759 AGCAAACATGTTGAAATAGTGGG - Intronic
974294944 4:59986027-59986049 AGTAAAAATATGGAAAACAATGG + Intergenic
974429762 4:61780501-61780523 AGTTAAAATATGGAAATCCAAGG - Intronic
976509015 4:85885694-85885716 ATCAAATATTTGGAAATAGATGG - Intronic
976554685 4:86436459-86436481 AGCAAACACATGGCAATCGATGG + Intronic
978015982 4:103747074-103747096 AGAAGAAATATGCAAATCGAAGG + Intergenic
980513868 4:133827381-133827403 TGCAAACATATGGCTATCTATGG + Intergenic
980825803 4:138071125-138071147 AGCAAAGATATGGAAACAAATGG + Intergenic
985224863 4:187749244-187749266 AGCAAAGATATCAAAATCCATGG + Intergenic
986044452 5:4023685-4023707 AGAAGACAAATGGAAATGGAAGG + Intergenic
986119799 5:4823139-4823161 AAAAAAAATATGGAAATGGATGG + Intergenic
986505637 5:8447681-8447703 AGCAAAAATATTGAAATGAAAGG - Intergenic
986512486 5:8523136-8523158 AGCTAACATCTGGAAAAAGAGGG - Intergenic
990195347 5:53308989-53309011 ACCAAACAAATGGAAAGCAAAGG - Intergenic
991135531 5:63177556-63177578 CTCAAACTTATGGAAATAGAAGG - Intergenic
992065263 5:73101561-73101583 AGCAAGTACATGGAAATAGAGGG + Intergenic
993485308 5:88476603-88476625 TACAAAAATATGGAAATCAAAGG + Intergenic
994668199 5:102733083-102733105 AGCAAATATATGGAAACGGTTGG - Intergenic
995087714 5:108134249-108134271 AGCAAACATATGAACATATATGG + Intronic
996902741 5:128561729-128561751 AGAAAACATATGGAAACTGCAGG - Intronic
998780319 5:145649033-145649055 TGCAAAAATATGGAAACCTATGG - Intronic
1001295851 5:170498306-170498328 TGCAAACATGAGGAAATTGAGGG + Intronic
1001303829 5:170556981-170557003 AGCCAGCATATGGAAATGGTGGG - Intronic
1003463077 6:6350681-6350703 AGCATACATATAGAAATAGACGG + Intergenic
1004286714 6:14327966-14327988 AGCAAACAAATCCAAATTGAGGG + Intergenic
1005619984 6:27611177-27611199 AACAAACATATGGAAAGACATGG - Intergenic
1011979450 6:93354241-93354263 AGCAAAAATATGGTAATGGAGGG + Intronic
1013030520 6:106328074-106328096 AGCAAAAATTTGGAAATAAAGGG + Intergenic
1013686319 6:112588742-112588764 AGCAAACATATGAGAATGGATGG + Intergenic
1017532524 6:155310437-155310459 AACAAATAGATGGAAATTGAGGG - Intronic
1018215792 6:161526677-161526699 AGCAAACATTTGCAAATGAATGG - Intronic
1019028174 6:168989963-168989985 AGAAAAGAAATGGAAATGGATGG - Intergenic
1021666690 7:22988997-22989019 AACAAACAGATGGAAAGGGAAGG + Intronic
1022606444 7:31819640-31819662 AGCAAATTTATGGATCTCGAGGG - Intronic
1023338233 7:39192468-39192490 AGTAAAGATATGGATATGGAAGG + Intronic
1024755188 7:52520987-52521009 AGCAGACATATGAAAATGGGAGG - Intergenic
1028449440 7:90964359-90964381 AGAAAACATATGGAAAACCTAGG + Intronic
1031403339 7:121352707-121352729 AGCAAACAAGTGGAAAGTGATGG - Intronic
1031447202 7:121869791-121869813 AGGAAACTTATGGAAAACTATGG + Intergenic
1031452709 7:121941530-121941552 AGCAAACAGATGAAAATAAAGGG - Intronic
1031856157 7:126924993-126925015 AGAAAAGATATAGAAATGGAGGG + Intronic
1033218303 7:139510253-139510275 AGCCAACATATGGAGAGAGACGG + Intergenic
1039542571 8:38383243-38383265 AGGAAACGTATGGAAAACAATGG + Intergenic
1039749147 8:40460882-40460904 AGCAAACATAGGCCCATCGAAGG - Intergenic
1042569262 8:70144855-70144877 AGAAAACAAATGAAAATTGAAGG + Intronic
1043664643 8:82793344-82793366 GCCAAACAAATGGAAATAGATGG - Intergenic
1045824127 8:106376718-106376740 AGCACACATGTGGAAATCAGAGG - Intronic
1046130019 8:109955235-109955257 AGCAGAGAGATGGAAATCTACGG - Intergenic
1046533305 8:115474997-115475019 AACAAAAATATGGAAAGCTAAGG + Intronic
1048387289 8:133923884-133923906 AGAAGACATATGGAAATCATGGG - Intergenic
1048650561 8:136471705-136471727 AACAAGCATATGGATATCAATGG + Intergenic
1048928139 8:139289423-139289445 GGCAAACATTTGGTAATCTATGG - Intergenic
1050097294 9:2079908-2079930 AACTCACATATGGAAGTCGAAGG - Intronic
1051249396 9:15144190-15144212 AGGAAAGATAGGGAAATCAATGG + Intergenic
1052582255 9:30373400-30373422 AGAAAACCTATGGAATTCAAAGG - Intergenic
1054739814 9:68793608-68793630 AGCTGAAATATGGAAATCTATGG + Intronic
1055046314 9:71928777-71928799 AGCAAAAGTATGGAAATAAAAGG + Intronic
1055280130 9:74664686-74664708 AGCAAACATATGTACAGCAAAGG + Intronic
1055448075 9:76402997-76403019 ACCGCACATATGGAAATGGAAGG + Intergenic
1058741163 9:107944165-107944187 ATGAAACATATGGAAGTTGAGGG + Intergenic
1060257649 9:122046822-122046844 AACCAAGATATGGAAATGGAAGG + Intronic
1191827464 X:65380767-65380789 ACCAAACAAATGGAAAACAAAGG + Intronic
1192805197 X:74502625-74502647 AGCAAATATAATGAAATAGATGG + Intronic
1193626336 X:83825594-83825616 ACCAAACATATCAAAATCAATGG + Intergenic
1194470661 X:94291283-94291305 TGCAAACATTTGGAATTCAAGGG + Intergenic
1195564955 X:106330130-106330152 AGAAAATATATGGAAATATATGG - Intergenic
1196099733 X:111835274-111835296 AACAAACAAATGGACATGGATGG - Intronic
1197693716 X:129528747-129528769 AGTAAATACATGGAAATCAATGG - Intergenic