ID: 924037332

View in Genome Browser
Species Human (GRCh38)
Location 1:239950564-239950586
Sequence TGAGCTCTGCTTCTCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924037330_924037332 3 Left 924037330 1:239950538-239950560 CCTTGCCAATGCTGTGATGAAAA No data
Right 924037332 1:239950564-239950586 TGAGCTCTGCTTCTCCCAGCAGG No data
924037331_924037332 -2 Left 924037331 1:239950543-239950565 CCAATGCTGTGATGAAAAGTGTG No data
Right 924037332 1:239950564-239950586 TGAGCTCTGCTTCTCCCAGCAGG No data
924037329_924037332 4 Left 924037329 1:239950537-239950559 CCCTTGCCAATGCTGTGATGAAA No data
Right 924037332 1:239950564-239950586 TGAGCTCTGCTTCTCCCAGCAGG No data
924037328_924037332 7 Left 924037328 1:239950534-239950556 CCTCCCTTGCCAATGCTGTGATG No data
Right 924037332 1:239950564-239950586 TGAGCTCTGCTTCTCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924037332 Original CRISPR TGAGCTCTGCTTCTCCCAGC AGG Intergenic
No off target data available for this crispr