ID: 924037881

View in Genome Browser
Species Human (GRCh38)
Location 1:239954772-239954794
Sequence AAAGGCCCTCTGAAGTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924037881_924037883 -6 Left 924037881 1:239954772-239954794 CCAGCAGACTTCAGAGGGCCTTT No data
Right 924037883 1:239954789-239954811 GCCTTTGTCCATCGCCAGTTGGG No data
924037881_924037887 8 Left 924037881 1:239954772-239954794 CCAGCAGACTTCAGAGGGCCTTT No data
Right 924037887 1:239954803-239954825 CCAGTTGGGCTGAACTGTGATGG No data
924037881_924037882 -7 Left 924037881 1:239954772-239954794 CCAGCAGACTTCAGAGGGCCTTT No data
Right 924037882 1:239954788-239954810 GGCCTTTGTCCATCGCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924037881 Original CRISPR AAAGGCCCTCTGAAGTCTGC TGG (reversed) Intergenic
No off target data available for this crispr