ID: 924039708

View in Genome Browser
Species Human (GRCh38)
Location 1:239972392-239972414
Sequence AGATGTTTATAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924039705_924039708 30 Left 924039705 1:239972339-239972361 CCAGATATCTTTAGTGCATTACA No data
Right 924039708 1:239972392-239972414 AGATGTTTATAGATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924039708 Original CRISPR AGATGTTTATAGATGGAGGA AGG Intergenic
No off target data available for this crispr