ID: 924043074

View in Genome Browser
Species Human (GRCh38)
Location 1:240002727-240002749
Sequence ACTCCCAGCATGCCGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924043074_924043076 -3 Left 924043074 1:240002727-240002749 CCTGGGCTCGGCATGCTGGGAGT No data
Right 924043076 1:240002747-240002769 AGTGTCTTCTAACCGGAGTGTGG No data
924043074_924043075 -10 Left 924043074 1:240002727-240002749 CCTGGGCTCGGCATGCTGGGAGT No data
Right 924043075 1:240002740-240002762 TGCTGGGAGTGTCTTCTAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924043074 Original CRISPR ACTCCCAGCATGCCGAGCCC AGG (reversed) Intergenic