ID: 924043773

View in Genome Browser
Species Human (GRCh38)
Location 1:240008669-240008691
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924043773_924043781 17 Left 924043773 1:240008669-240008691 CCCTGTCTGCATCCCACGTGGGC No data
Right 924043781 1:240008709-240008731 TGACAGTAGGCACAGCTGCTCGG No data
924043773_924043780 4 Left 924043773 1:240008669-240008691 CCCTGTCTGCATCCCACGTGGGC No data
Right 924043780 1:240008696-240008718 TGTGTGTGAGCATTGACAGTAGG No data
924043773_924043784 24 Left 924043773 1:240008669-240008691 CCCTGTCTGCATCCCACGTGGGC No data
Right 924043784 1:240008716-240008738 AGGCACAGCTGCTCGGGAAAGGG No data
924043773_924043783 23 Left 924043773 1:240008669-240008691 CCCTGTCTGCATCCCACGTGGGC No data
Right 924043783 1:240008715-240008737 TAGGCACAGCTGCTCGGGAAAGG No data
924043773_924043782 18 Left 924043773 1:240008669-240008691 CCCTGTCTGCATCCCACGTGGGC No data
Right 924043782 1:240008710-240008732 GACAGTAGGCACAGCTGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924043773 Original CRISPR GCCCACGTGGGATGCAGACA GGG (reversed) Intergenic