ID: 924043774

View in Genome Browser
Species Human (GRCh38)
Location 1:240008670-240008692
Sequence GGCCCACGTGGGATGCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924043774_924043784 23 Left 924043774 1:240008670-240008692 CCTGTCTGCATCCCACGTGGGCC No data
Right 924043784 1:240008716-240008738 AGGCACAGCTGCTCGGGAAAGGG No data
924043774_924043780 3 Left 924043774 1:240008670-240008692 CCTGTCTGCATCCCACGTGGGCC No data
Right 924043780 1:240008696-240008718 TGTGTGTGAGCATTGACAGTAGG No data
924043774_924043781 16 Left 924043774 1:240008670-240008692 CCTGTCTGCATCCCACGTGGGCC No data
Right 924043781 1:240008709-240008731 TGACAGTAGGCACAGCTGCTCGG No data
924043774_924043782 17 Left 924043774 1:240008670-240008692 CCTGTCTGCATCCCACGTGGGCC No data
Right 924043782 1:240008710-240008732 GACAGTAGGCACAGCTGCTCGGG No data
924043774_924043783 22 Left 924043774 1:240008670-240008692 CCTGTCTGCATCCCACGTGGGCC No data
Right 924043783 1:240008715-240008737 TAGGCACAGCTGCTCGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924043774 Original CRISPR GGCCCACGTGGGATGCAGAC AGG (reversed) Intergenic
No off target data available for this crispr