ID: 924043775

View in Genome Browser
Species Human (GRCh38)
Location 1:240008681-240008703
Sequence CACACACACGGGGCCCACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924043775_924043780 -8 Left 924043775 1:240008681-240008703 CCCACGTGGGCCCCGTGTGTGTG No data
Right 924043780 1:240008696-240008718 TGTGTGTGAGCATTGACAGTAGG No data
924043775_924043783 11 Left 924043775 1:240008681-240008703 CCCACGTGGGCCCCGTGTGTGTG No data
Right 924043783 1:240008715-240008737 TAGGCACAGCTGCTCGGGAAAGG No data
924043775_924043784 12 Left 924043775 1:240008681-240008703 CCCACGTGGGCCCCGTGTGTGTG No data
Right 924043784 1:240008716-240008738 AGGCACAGCTGCTCGGGAAAGGG No data
924043775_924043781 5 Left 924043775 1:240008681-240008703 CCCACGTGGGCCCCGTGTGTGTG No data
Right 924043781 1:240008709-240008731 TGACAGTAGGCACAGCTGCTCGG No data
924043775_924043782 6 Left 924043775 1:240008681-240008703 CCCACGTGGGCCCCGTGTGTGTG No data
Right 924043782 1:240008710-240008732 GACAGTAGGCACAGCTGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924043775 Original CRISPR CACACACACGGGGCCCACGT GGG (reversed) Intergenic