ID: 924043776

View in Genome Browser
Species Human (GRCh38)
Location 1:240008682-240008704
Sequence TCACACACACGGGGCCCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924043776_924043782 5 Left 924043776 1:240008682-240008704 CCACGTGGGCCCCGTGTGTGTGA No data
Right 924043782 1:240008710-240008732 GACAGTAGGCACAGCTGCTCGGG No data
924043776_924043783 10 Left 924043776 1:240008682-240008704 CCACGTGGGCCCCGTGTGTGTGA No data
Right 924043783 1:240008715-240008737 TAGGCACAGCTGCTCGGGAAAGG No data
924043776_924043781 4 Left 924043776 1:240008682-240008704 CCACGTGGGCCCCGTGTGTGTGA No data
Right 924043781 1:240008709-240008731 TGACAGTAGGCACAGCTGCTCGG No data
924043776_924043780 -9 Left 924043776 1:240008682-240008704 CCACGTGGGCCCCGTGTGTGTGA No data
Right 924043780 1:240008696-240008718 TGTGTGTGAGCATTGACAGTAGG No data
924043776_924043784 11 Left 924043776 1:240008682-240008704 CCACGTGGGCCCCGTGTGTGTGA No data
Right 924043784 1:240008716-240008738 AGGCACAGCTGCTCGGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924043776 Original CRISPR TCACACACACGGGGCCCACG TGG (reversed) Intergenic