ID: 924043778

View in Genome Browser
Species Human (GRCh38)
Location 1:240008692-240008714
Sequence CTGTCAATGCTCACACACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924043778_924043782 -5 Left 924043778 1:240008692-240008714 CCCGTGTGTGTGAGCATTGACAG No data
Right 924043782 1:240008710-240008732 GACAGTAGGCACAGCTGCTCGGG No data
924043778_924043783 0 Left 924043778 1:240008692-240008714 CCCGTGTGTGTGAGCATTGACAG No data
Right 924043783 1:240008715-240008737 TAGGCACAGCTGCTCGGGAAAGG No data
924043778_924043784 1 Left 924043778 1:240008692-240008714 CCCGTGTGTGTGAGCATTGACAG No data
Right 924043784 1:240008716-240008738 AGGCACAGCTGCTCGGGAAAGGG No data
924043778_924043781 -6 Left 924043778 1:240008692-240008714 CCCGTGTGTGTGAGCATTGACAG No data
Right 924043781 1:240008709-240008731 TGACAGTAGGCACAGCTGCTCGG No data
924043778_924043785 22 Left 924043778 1:240008692-240008714 CCCGTGTGTGTGAGCATTGACAG No data
Right 924043785 1:240008737-240008759 GGTCCACCTGTGTCTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924043778 Original CRISPR CTGTCAATGCTCACACACAC GGG (reversed) Intergenic