ID: 924043779

View in Genome Browser
Species Human (GRCh38)
Location 1:240008693-240008715
Sequence ACTGTCAATGCTCACACACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924043779_924043785 21 Left 924043779 1:240008693-240008715 CCGTGTGTGTGAGCATTGACAGT No data
Right 924043785 1:240008737-240008759 GGTCCACCTGTGTCTTCCCCAGG No data
924043779_924043782 -6 Left 924043779 1:240008693-240008715 CCGTGTGTGTGAGCATTGACAGT No data
Right 924043782 1:240008710-240008732 GACAGTAGGCACAGCTGCTCGGG No data
924043779_924043783 -1 Left 924043779 1:240008693-240008715 CCGTGTGTGTGAGCATTGACAGT No data
Right 924043783 1:240008715-240008737 TAGGCACAGCTGCTCGGGAAAGG No data
924043779_924043784 0 Left 924043779 1:240008693-240008715 CCGTGTGTGTGAGCATTGACAGT No data
Right 924043784 1:240008716-240008738 AGGCACAGCTGCTCGGGAAAGGG No data
924043779_924043781 -7 Left 924043779 1:240008693-240008715 CCGTGTGTGTGAGCATTGACAGT No data
Right 924043781 1:240008709-240008731 TGACAGTAGGCACAGCTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924043779 Original CRISPR ACTGTCAATGCTCACACACA CGG (reversed) Intergenic