ID: 924043780

View in Genome Browser
Species Human (GRCh38)
Location 1:240008696-240008718
Sequence TGTGTGTGAGCATTGACAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924043776_924043780 -9 Left 924043776 1:240008682-240008704 CCACGTGGGCCCCGTGTGTGTGA No data
Right 924043780 1:240008696-240008718 TGTGTGTGAGCATTGACAGTAGG No data
924043773_924043780 4 Left 924043773 1:240008669-240008691 CCCTGTCTGCATCCCACGTGGGC No data
Right 924043780 1:240008696-240008718 TGTGTGTGAGCATTGACAGTAGG No data
924043770_924043780 13 Left 924043770 1:240008660-240008682 CCGTGTTTGCCCTGTCTGCATCC No data
Right 924043780 1:240008696-240008718 TGTGTGTGAGCATTGACAGTAGG No data
924043774_924043780 3 Left 924043774 1:240008670-240008692 CCTGTCTGCATCCCACGTGGGCC No data
Right 924043780 1:240008696-240008718 TGTGTGTGAGCATTGACAGTAGG No data
924043769_924043780 14 Left 924043769 1:240008659-240008681 CCCGTGTTTGCCCTGTCTGCATC No data
Right 924043780 1:240008696-240008718 TGTGTGTGAGCATTGACAGTAGG No data
924043775_924043780 -8 Left 924043775 1:240008681-240008703 CCCACGTGGGCCCCGTGTGTGTG No data
Right 924043780 1:240008696-240008718 TGTGTGTGAGCATTGACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924043780 Original CRISPR TGTGTGTGAGCATTGACAGT AGG Intergenic
No off target data available for this crispr