ID: 924043782

View in Genome Browser
Species Human (GRCh38)
Location 1:240008710-240008732
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924043769_924043782 28 Left 924043769 1:240008659-240008681 CCCGTGTTTGCCCTGTCTGCATC No data
Right 924043782 1:240008710-240008732 GACAGTAGGCACAGCTGCTCGGG No data
924043777_924043782 -4 Left 924043777 1:240008691-240008713 CCCCGTGTGTGTGAGCATTGACA No data
Right 924043782 1:240008710-240008732 GACAGTAGGCACAGCTGCTCGGG No data
924043776_924043782 5 Left 924043776 1:240008682-240008704 CCACGTGGGCCCCGTGTGTGTGA No data
Right 924043782 1:240008710-240008732 GACAGTAGGCACAGCTGCTCGGG No data
924043775_924043782 6 Left 924043775 1:240008681-240008703 CCCACGTGGGCCCCGTGTGTGTG No data
Right 924043782 1:240008710-240008732 GACAGTAGGCACAGCTGCTCGGG No data
924043773_924043782 18 Left 924043773 1:240008669-240008691 CCCTGTCTGCATCCCACGTGGGC No data
Right 924043782 1:240008710-240008732 GACAGTAGGCACAGCTGCTCGGG No data
924043770_924043782 27 Left 924043770 1:240008660-240008682 CCGTGTTTGCCCTGTCTGCATCC No data
Right 924043782 1:240008710-240008732 GACAGTAGGCACAGCTGCTCGGG No data
924043779_924043782 -6 Left 924043779 1:240008693-240008715 CCGTGTGTGTGAGCATTGACAGT No data
Right 924043782 1:240008710-240008732 GACAGTAGGCACAGCTGCTCGGG No data
924043778_924043782 -5 Left 924043778 1:240008692-240008714 CCCGTGTGTGTGAGCATTGACAG No data
Right 924043782 1:240008710-240008732 GACAGTAGGCACAGCTGCTCGGG No data
924043774_924043782 17 Left 924043774 1:240008670-240008692 CCTGTCTGCATCCCACGTGGGCC No data
Right 924043782 1:240008710-240008732 GACAGTAGGCACAGCTGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr