ID: 924043785

View in Genome Browser
Species Human (GRCh38)
Location 1:240008737-240008759
Sequence GGTCCACCTGTGTCTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924043779_924043785 21 Left 924043779 1:240008693-240008715 CCGTGTGTGTGAGCATTGACAGT No data
Right 924043785 1:240008737-240008759 GGTCCACCTGTGTCTTCCCCAGG No data
924043777_924043785 23 Left 924043777 1:240008691-240008713 CCCCGTGTGTGTGAGCATTGACA No data
Right 924043785 1:240008737-240008759 GGTCCACCTGTGTCTTCCCCAGG No data
924043778_924043785 22 Left 924043778 1:240008692-240008714 CCCGTGTGTGTGAGCATTGACAG No data
Right 924043785 1:240008737-240008759 GGTCCACCTGTGTCTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924043785 Original CRISPR GGTCCACCTGTGTCTTCCCC AGG Intergenic