ID: 924048379

View in Genome Browser
Species Human (GRCh38)
Location 1:240055454-240055476
Sequence AGAGGTACCCTGCAGTTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924048379_924048386 19 Left 924048379 1:240055454-240055476 CCAGCTAACTGCAGGGTACCTCT 0: 1
1: 0
2: 2
3: 11
4: 122
Right 924048386 1:240055496-240055518 TACTGGACTGTCAATGGTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 65
924048379_924048385 13 Left 924048379 1:240055454-240055476 CCAGCTAACTGCAGGGTACCTCT 0: 1
1: 0
2: 2
3: 11
4: 122
Right 924048385 1:240055490-240055512 ACGAACTACTGGACTGTCAATGG 0: 1
1: 0
2: 0
3: 2
4: 36
924048379_924048382 2 Left 924048379 1:240055454-240055476 CCAGCTAACTGCAGGGTACCTCT 0: 1
1: 0
2: 2
3: 11
4: 122
Right 924048382 1:240055479-240055501 CTAAGCCCAGAACGAACTACTGG 0: 1
1: 0
2: 0
3: 2
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924048379 Original CRISPR AGAGGTACCCTGCAGTTAGC TGG (reversed) Intronic
901636891 1:10674708-10674730 CGCGGTGCCCTGCAGTTACCAGG - Intronic
906689554 1:47783642-47783664 AGAGGTTCCCTGCTCTGAGCAGG + Intronic
909566367 1:77057624-77057646 AGAGGTACCCTCCATATATCCGG - Intronic
910428584 1:87139487-87139509 AGCGCTACCATGCACTTAGCAGG - Intronic
911646056 1:100338107-100338129 AGAGGAAGCCTCCAGGTAGCAGG + Intergenic
912271647 1:108216572-108216594 AGAGGAAGCGGGCAGTTAGCAGG - Intergenic
912810803 1:112792969-112792991 AGAGGAAGCCTCCAGGTAGCAGG + Intergenic
913497897 1:119445334-119445356 ACCAGTACCCTCCAGTTAGCCGG + Intergenic
914220676 1:145679206-145679228 GGAGATACCCAGCAGCTAGCTGG - Intronic
914473255 1:148002079-148002101 GGAGATACCCAGCAGCTAGCTGG - Intergenic
915322255 1:155062355-155062377 AGTGGTACCCTCCAGGTAGGAGG + Exonic
916746374 1:167687803-167687825 GGAGGGGCCCTGCAGTCAGCAGG - Intronic
921813319 1:219538990-219539012 AGAGGTACCTTGCATATACCAGG - Intergenic
923552498 1:234975299-234975321 AGAGCTACCATGCAGTGAACTGG - Intergenic
923685032 1:236147800-236147822 TGAGGTGCCCTGCTGGTAGCAGG + Intronic
923755943 1:236791287-236791309 AGAGGAAGCCTTCAGGTAGCAGG - Intergenic
924048379 1:240055454-240055476 AGAGGTACCCTGCAGTTAGCTGG - Intronic
924650219 1:245919126-245919148 AAAGGTACACTGCAGGCAGCGGG - Intronic
1063434889 10:6021675-6021697 GGAGGTTCCCTGCAGTGACCTGG + Exonic
1068505360 10:57893433-57893455 AGAGGAAGCCTCCAGGTAGCAGG + Intergenic
1071601299 10:86959855-86959877 AGAGGTGCCCTGGAGTCAGAGGG + Intronic
1072751237 10:97980450-97980472 AAAGCCACCCTACAGTTAGCAGG - Intronic
1074160620 10:110833789-110833811 AAAGCTACACTGCAGTTGGCTGG - Intronic
1074368647 10:112880656-112880678 AGAGGTTGGCTGCAGTTAACAGG - Intergenic
1076356145 10:129855114-129855136 AGAAATACCCTGCAGTGAGCGGG - Intronic
1081323168 11:41715787-41715809 AGAGGAAGCCTCCAGGTAGCAGG + Intergenic
1083196416 11:61091246-61091268 AGTGGTACCCTGGCGTGAGCGGG - Intergenic
1083726323 11:64630394-64630416 AGCGGTACCCGGCAGGTAGGCGG - Exonic
1085602487 11:77867861-77867883 AGAAGTTTCCTGGAGTTAGCTGG + Intronic
1087264414 11:96044652-96044674 AGAGCAACCATGCAGGTAGCTGG + Intronic
1093136736 12:15461125-15461147 AGAGGAAACCTTCAGTTAGTAGG - Intronic
1097352923 12:58568405-58568427 AGAGGAACCCTGAAGGTAGAGGG + Intronic
1103565417 12:121812860-121812882 AGAGGAAAACTGCAGGTAGCGGG - Intronic
1104229799 12:126873836-126873858 AGATGAACCCTCCAGGTAGCAGG - Intergenic
1104304193 12:127594496-127594518 AGAGGAAGCCTTCAGGTAGCAGG + Intergenic
1104781830 12:131426587-131426609 AGATGAAGCCTCCAGTTAGCAGG - Intergenic
1109850561 13:68057555-68057577 ATAGGATCCCTGCAATTAGCAGG + Intergenic
1110322494 13:74175850-74175872 TGAGGCACCCTGGAATTAGCTGG - Intergenic
1117272638 14:54160682-54160704 AGAGGTTCCCTCAAGTCAGCTGG - Intergenic
1117335266 14:54751993-54752015 ACAGGTACACTGCAGATAGTGGG + Intronic
1118767133 14:68917320-68917342 ATAGGTACCCTGTAGGTAGGTGG - Intronic
1123016309 14:105377253-105377275 GGAGGTCCCCTGCAGTTCCCAGG - Intronic
1125824948 15:42668228-42668250 ACAGGTACCCTGTAGTTTCCTGG + Intronic
1127305807 15:57704880-57704902 AGATGAAGCCTCCAGTTAGCAGG - Intronic
1127635080 15:60861404-60861426 AGAGTAACCCTGGAGGTAGCTGG + Intronic
1130996282 15:88906158-88906180 AGAGGTACCCTGTAGGTTACAGG - Intronic
1135252965 16:20916535-20916557 AGAGGACCCCTGCAGCTGGCGGG - Intronic
1140056191 16:71527828-71527850 AGAGGAAGCCTTCAGATAGCAGG + Intronic
1145223289 17:21106673-21106695 AGAGGAAACCTCCAGGTAGCAGG + Intergenic
1147041248 17:37721091-37721113 AGAGGCACCCTGCAGTGGACAGG + Intronic
1147906431 17:43825994-43826016 TGAGGTGCCCAGCACTTAGCAGG - Intronic
1151298038 17:73200036-73200058 AGAGCTTCCCTGCAGCTGGCAGG + Intronic
1153572634 18:6488442-6488464 AGAGGAAGCCTCCAGGTAGCAGG - Intergenic
1154059596 18:11047166-11047188 GGAGGTACCATGCAGTAAGGAGG - Intronic
1154346137 18:13545139-13545161 AGAGATCCCCTGCAATCAGCTGG - Intronic
1158316596 18:56217898-56217920 AGACCTAACCTGCAGTTTGCAGG + Intergenic
1158563174 18:58532440-58532462 AGAGTTACCCTTGAGTCAGCAGG - Intronic
1158917742 18:62152239-62152261 AGAGGAACCCTTCAGATAGTAGG + Intronic
1160563419 18:79772658-79772680 TGAGGTTCCCGGCAGTGAGCGGG - Intergenic
1160765879 19:807602-807624 AGAAGTACCGTGCAGTCAGTTGG - Intronic
1164613601 19:29650736-29650758 AGAGGAAGCCTCCAGGTAGCAGG + Intergenic
1167163866 19:47784871-47784893 AGAGGGACACTGCAGTAAGCTGG - Intergenic
927083668 2:19654161-19654183 AGAGGAAACCTGAAGCTAGCAGG + Intergenic
930092595 2:47542069-47542091 AACAGTCCCCTGCAGTTAGCAGG - Intronic
933345130 2:81074701-81074723 AAACTTACCCAGCAGTTAGCAGG + Intergenic
936036844 2:109120160-109120182 ACAGGTAGCCTGCAGTGAGCAGG - Intergenic
936874613 2:117173276-117173298 AGAGGTTGCATGCAGTGAGCAGG - Intergenic
937348395 2:121142697-121142719 AGCTGTACCCTGCAGTTGGTGGG + Intergenic
944547032 2:200809341-200809363 ATAGGCACCGTGCAGCTAGCAGG - Intergenic
946125696 2:217560722-217560744 AGAGGAAGCCTTCAGGTAGCAGG - Intronic
948576692 2:238956268-238956290 AGAGGTATCGTGCAGGTGGCGGG + Intergenic
948990779 2:241552851-241552873 AGAGGCAGCCTGCAGTGACCGGG + Intergenic
1169791006 20:9410671-9410693 AGAGGAACCCTGGAGATACCCGG - Intronic
1177255840 21:18662033-18662055 AGAGGAAGCCTTCAGATAGCAGG - Intergenic
1181265148 22:21626748-21626770 AGGGGTGGCCTGAAGTTAGCCGG - Intergenic
1181329220 22:22076160-22076182 AGAGGAAGCCTCCAGGTAGCAGG + Intergenic
1181424680 22:22826586-22826608 AGAGGAAGCCTCCAGGTAGCAGG - Intronic
1182950009 22:34364989-34365011 AGATGCTCCCTGCAGTAAGCAGG + Intergenic
952073494 3:29668577-29668599 AGAAGTAACCAGAAGTTAGCTGG + Intronic
954373842 3:50184103-50184125 AGAGGTAACCTGGAGTCAGAAGG + Intronic
956878708 3:73489140-73489162 AGAGGTACCCAGCAGCTAGTGGG + Intronic
960744657 3:120873877-120873899 AGAGGAAGCCTCCAGGTAGCAGG + Intergenic
961313826 3:126020743-126020765 AGAGGAAGCCTTCAGGTAGCAGG - Intronic
961676995 3:128573684-128573706 AGTGGTCCGCTGCAGTGAGCTGG - Exonic
961794298 3:129398585-129398607 AGAGGAAGCCTCCAGGTAGCGGG - Intergenic
962421414 3:135232500-135232522 AGAGTCACCCTGGAGTTGGCAGG - Intronic
964911624 3:161789644-161789666 AGAGGCACCCTGCACATACCTGG + Intergenic
966817094 3:183898113-183898135 GGAGGTACCCAGCAGGTAGATGG - Intergenic
968884207 4:3318588-3318610 TGAGGTACCCCTCAGTGAGCAGG - Intronic
969346356 4:6572958-6572980 AGATGAAGCCTCCAGTTAGCAGG - Intergenic
972177559 4:36427215-36427237 AGAGCTACCCAGCACTTTGCAGG + Intergenic
972637759 4:40899436-40899458 AGAGGTCCTCTGCAGGTAGATGG - Intronic
974674618 4:65073816-65073838 AGAGGTAGCCTCCAGGTAGCAGG + Intergenic
975578964 4:75890028-75890050 AGAGGTACCCGACAGTTACACGG - Exonic
978099745 4:104823620-104823642 AGAGTTATCCTGCAGTTGTCAGG + Intergenic
984001372 4:174250628-174250650 AAATGTACACTACAGTTAGCTGG + Intronic
993308890 5:86303431-86303453 AGAGGAAGCGGGCAGTTAGCAGG + Intergenic
995058223 5:107786198-107786220 AGAGGAATCCTGCAGTAAGCAGG + Intergenic
996289979 5:121841110-121841132 AGAGGCAGCATGCAGATAGCGGG - Intergenic
999268662 5:150283534-150283556 AGAGTTACCCAGAGGTTAGCTGG - Intronic
1000172137 5:158712623-158712645 AGATGTACCCTGGAGTTAACAGG + Intronic
1003502265 6:6712422-6712444 AGTGGTACCCTGCTGGTGGCTGG - Intergenic
1005889009 6:30121063-30121085 AGAGGAAGCCTTCAGGTAGCAGG + Intergenic
1011120115 6:83942917-83942939 AGAGGTGCCCTGCAGAGAGGAGG - Intronic
1013475971 6:110507684-110507706 AGAGGAAGCCTGCAGGTAGTCGG - Intergenic
1014621164 6:123668351-123668373 AGAGGTAGCCTGAAGTAACCTGG + Intergenic
1015454736 6:133413770-133413792 AGAGATATCCAGCAGTCAGCAGG - Intronic
1016521520 6:144951913-144951935 AGATGAAGCCTGCAGGTAGCAGG - Intergenic
1017576488 6:155810699-155810721 AAAGGGACCATTCAGTTAGCCGG + Intergenic
1018807512 6:167272808-167272830 AGAGGAAGCCTTCAGGTAGCAGG + Intronic
1020680777 7:11234052-11234074 AGATGAAGCCTCCAGTTAGCAGG + Intergenic
1021585143 7:22199659-22199681 AGAGGTACAGTTCAGGTAGCTGG + Intronic
1022389234 7:29929008-29929030 AGAGGTAGCCTGGAGACAGCTGG - Intronic
1027595848 7:80173164-80173186 ACATGAACCCTGCAGTCAGCAGG - Intronic
1029409904 7:100402436-100402458 AGAGGGAGTCTGCAGGTAGCTGG - Intronic
1033099617 7:138459704-138459726 AGAGGTACTCTGGAGGCAGCAGG - Intergenic
1033159348 7:138982054-138982076 CGCGGGACCCTGCACTTAGCAGG + Intergenic
1038406097 8:27324163-27324185 AGAGGTACACTGAAGTTAGCAGG - Intronic
1038506681 8:28090852-28090874 AGAGGAAGCCTCCAGGTAGCAGG + Intronic
1044915880 8:97112411-97112433 AGAGTTACCCAGAAGTCAGCTGG + Intronic
1048777912 8:137967831-137967853 AGATGAAGCCTGCAGGTAGCAGG - Intergenic
1049112642 8:140657500-140657522 AGAGTTTACCTGCAGTTAGCCGG - Intergenic
1050941057 9:11458507-11458529 AGAGATTCCCTGCAGTAAGCAGG - Intergenic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1052277555 9:26694386-26694408 AGAGCTACCCTGCAGCTAGAAGG + Intergenic
1054868979 9:70031731-70031753 AGAGGTACCCTGTACTTTGAGGG - Intergenic
1056142195 9:83693289-83693311 AGAGGTAACCTTCAGTTAGCTGG - Intronic
1058432907 9:104934758-104934780 AGAGGAAGCCTTCAGGTAGCAGG + Intergenic
1058739275 9:107926612-107926634 AGAGGAACCATGGAGTTAGATGG + Intergenic
1186440381 X:9580847-9580869 AGATGTAGCCTCCAGGTAGCAGG + Intronic
1187324624 X:18274909-18274931 AGATGAAACCTGCAGGTAGCAGG - Intronic
1189227077 X:39421936-39421958 ACAGCTGCCCTGCAGTGAGCAGG + Intergenic
1189463351 X:41259948-41259970 AGAGCTACCCTGCATTGAGAAGG + Intergenic
1194104613 X:89753398-89753420 AGAGGGAGCCTCCAGGTAGCAGG + Intergenic
1196870321 X:120107436-120107458 AGAGGAAGCCTCCAGGTAGCTGG + Intergenic
1201276787 Y:12306089-12306111 ACATGTAGCCTGCAGTTAGCAGG + Intergenic