ID: 924049035

View in Genome Browser
Species Human (GRCh38)
Location 1:240061787-240061809
Sequence CAGAATAAACAAACAGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1032
Summary {0: 1, 1: 0, 2: 7, 3: 112, 4: 912}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924049034_924049035 5 Left 924049034 1:240061759-240061781 CCTTAGAGACAAAAGTTTTCATG 0: 1
1: 0
2: 1
3: 22
4: 253
Right 924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG 0: 1
1: 0
2: 7
3: 112
4: 912

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924049035 Original CRISPR CAGAATAAACAAACAGACAA TGG Intronic
900015690 1:147589-147611 AAGAAAAAAAAAACAGATAATGG + Intergenic
900045953 1:506187-506209 AAGAAAAAAAAAACAGATAATGG + Intergenic
900068155 1:747898-747920 AAGAAAAAAAAAACAGATAATGG + Intergenic
900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG + Intergenic
901090363 1:6636845-6636867 CAAAACAAACAAACAAACAGTGG - Intronic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
901277570 1:8004589-8004611 AAAAACAAACAAACAAACAAGGG + Intronic
901382831 1:8886312-8886334 CAAAACAAACAAACAAAAAAAGG + Intergenic
901576675 1:10206756-10206778 CAAAACAAACAAACAAAAAAAGG - Intergenic
902036779 1:13463732-13463754 CAGAGAAGACAAACAAACAAGGG - Intergenic
902205375 1:14864565-14864587 AAGAAAAAACAAACAAACGATGG + Intronic
902420538 1:16275962-16275984 CAAAATAAATAAACAAAAAAGGG + Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903052821 1:20614227-20614249 CAAAATAAATAAACAAACAGTGG + Intronic
903477898 1:23632935-23632957 CAGAACAAATAAACACACAAGGG - Intronic
903725409 1:25439400-25439422 AAAAATAAACAAACAAAAAAGGG + Intronic
904155011 1:28475722-28475744 CAAAAAAAAAAAAAAGACAAAGG - Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904843815 1:33392964-33392986 CAGAATAAACCAACCCAAAAGGG + Intronic
905870014 1:41398020-41398042 CAGAGTGAACAAGCAGACAAGGG - Intergenic
906172000 1:43734133-43734155 CTGAGTAAATAAAGAGACAAAGG - Intronic
906189633 1:43888489-43888511 ATAAATAAACAAACAAACAAGGG + Intronic
907183976 1:52594999-52595021 AAAAACAAACAAACAAACAAGGG + Intergenic
907250943 1:53139036-53139058 CAGAGTAAACGAAGAGAAAAGGG - Intronic
907411035 1:54283371-54283393 CAAAATAAACGAACAGACCTGGG + Intronic
908244285 1:62215393-62215415 CTCAATATACAAACATACAATGG - Intergenic
908523806 1:64968629-64968651 AAAAACAAACAAACAAACAAAGG + Intergenic
908591092 1:65634876-65634898 CAGAAAAAAAAAACAGGCATAGG + Intronic
908870973 1:68611776-68611798 AAAAATAAACAAAGAAACAATGG - Intergenic
909029913 1:70527468-70527490 CAGCAGAAACAAGCAGACATTGG - Intergenic
909221031 1:72962127-72962149 AAAAACAAACAAACAAACAAGGG - Intergenic
909278921 1:73723797-73723819 CAGAATCAACATGCAGAGAAGGG + Intergenic
909732565 1:78912835-78912857 CAGAATAAACAGACAACCTATGG + Intronic
909869889 1:80726114-80726136 CAGAAAAAAAAATGAGACAATGG - Intergenic
909959139 1:81817124-81817146 CAGAATAGAAAAACAGACACTGG - Intronic
910036750 1:82798229-82798251 TAGAATAATAAAATAGACAAGGG - Intergenic
910157742 1:84239451-84239473 CATAAGAAGCACACAGACAAAGG + Intergenic
910239313 1:85069382-85069404 CAGAACAAATAAACAAATAAAGG - Intronic
911081133 1:93932421-93932443 CAGAATAAACAGACAACCCACGG + Intergenic
911280366 1:95919500-95919522 AAGGATAAACATACAGATAATGG + Intergenic
912010196 1:104949941-104949963 CACAATAAAAAAACAGGCAAAGG + Intergenic
912574216 1:110650140-110650162 AAGAATAAATGAATAGACAAAGG + Intergenic
913119990 1:115731091-115731113 CAGAATATTTAAAGAGACAAAGG - Intronic
913665922 1:121048845-121048867 CAGAATATACAATCGAACAATGG + Intergenic
914017320 1:143832121-143832143 CAGAATATACAATCGAACAATGG + Intergenic
914432988 1:147636479-147636501 CAGATAAAGCAAAGAGACAAAGG + Intronic
914655931 1:149740653-149740675 CAGAATATACAATCGAACAATGG + Intergenic
915171879 1:153983688-153983710 CAGAATAAGGAAACAGTAAAGGG + Intronic
915468681 1:156113323-156113345 CAAAAAAAACAAACAAACAGAGG + Intronic
916018536 1:160772830-160772852 CAGAAAGAGAAAACAGACAATGG + Intergenic
916286083 1:163107317-163107339 CAGCAACAACAAACAGAGAAGGG + Intergenic
916477244 1:165181982-165182004 CAGGATATATAAATAGACAAAGG + Intergenic
916968857 1:169986518-169986540 CAGAATAAAAAAAGATTCAAGGG + Intronic
917040388 1:170799696-170799718 CAGAATAAATAAACAAACTGAGG + Intergenic
917413997 1:174789333-174789355 CATACTAAAAAAACAGACCACGG - Intronic
917555199 1:176078694-176078716 CAGAGTAAACAGACAGCCTAGGG + Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918205790 1:182308036-182308058 CAGAATAAATAAATACAGAAAGG - Intergenic
918227555 1:182498787-182498809 AAAAAAAAACAAACAAACAAAGG - Intronic
918620936 1:186605138-186605160 TATAATAAACAAACACTCAAAGG - Intergenic
918636104 1:186776174-186776196 GAGAAAAAACAAACAAACATGGG + Intergenic
918833176 1:189425037-189425059 AAGAAAAAACAAACAGAAGAAGG - Intergenic
918960295 1:191266831-191266853 GAGAATGAACACACAGACACTGG - Intergenic
919122843 1:193362512-193362534 AAAAATAAAAAAACAGACACAGG - Intergenic
919126061 1:193395304-193395326 CTGAATATGGAAACAGACAATGG + Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
920728460 1:208460297-208460319 AACAACAAACAAATAGACAATGG - Intergenic
920784757 1:209030487-209030509 CAGATTAAACAAAAAAATAAAGG - Intergenic
921109967 1:212026145-212026167 CAAAAAAAACAAAAAGACAAAGG + Intronic
921242210 1:213196832-213196854 CAAAACAAACAAACAAAAAAAGG - Intronic
922083371 1:222320480-222320502 TAGAACAAACAAAAATACAATGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922630093 1:227098067-227098089 CAGAATAAAGAATTAGACCAAGG - Intronic
922992834 1:229930347-229930369 AAGCACAAACAAAAAGACAATGG + Intergenic
923525925 1:234772721-234772743 CAGAATAAACAAAGAGATGCTGG - Intergenic
923605833 1:235441735-235441757 CAAAACAAACAAACAAACAAAGG - Intronic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924083088 1:240419993-240420015 CATAATAACCAAAAAGCCAAGGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924345685 1:243070796-243070818 AAGAAAAAAAAAACAGATAATGG + Intergenic
924742690 1:246805405-246805427 CAAAACAAACAAAAAGCCAATGG - Intergenic
1062908319 10:1194903-1194925 CACAAAAAACAAGCAGACACAGG - Intronic
1063263494 10:4417704-4417726 CAAAATATACAAACATGCAAAGG - Intergenic
1063422590 10:5925169-5925191 CAGAAAAAAGAAAAAGACGAGGG - Intronic
1063776534 10:9272016-9272038 CAGAATGAAGAAACAAACTATGG - Intergenic
1063827970 10:9920256-9920278 CAGATTACACATGCAGACAAGGG - Intergenic
1064064674 10:12171352-12171374 CAGAATAGACAAACTGATAGAGG - Intronic
1064432871 10:15286278-15286300 CTAAACAAACAAACAAACAAAGG - Intronic
1064488077 10:15818321-15818343 AAAAAAAAACAAACAAACAAAGG + Intronic
1064705023 10:18062684-18062706 AGGAAGAAACAAACAGAAAATGG - Intergenic
1065031820 10:21594194-21594216 CAGAAACAACCAACAGAAAAAGG - Intronic
1065582685 10:27187355-27187377 AGGAATAAACAAAAAGACTAAGG + Intergenic
1065677415 10:28192910-28192932 AAGTATAAACAAATAGATAATGG + Intronic
1066333811 10:34455589-34455611 CAGAAAAAAGAGACAGATAAGGG + Intronic
1066358762 10:34710781-34710803 GAGAATAAACAAAAACATAAGGG - Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066812163 10:39354445-39354467 CAAAATAAAAAAAAAGAAAAAGG - Intergenic
1067071230 10:43133729-43133751 CTGAACATGCAAACAGACAATGG - Intergenic
1067433542 10:46262044-46262066 CCTAAATAACAAACAGACAAGGG - Intergenic
1067798540 10:49339366-49339388 AATAATAAACAACCAGACAAAGG + Intergenic
1068491962 10:57735658-57735680 TAAAATAAACAAACATGCAAAGG + Intergenic
1068514361 10:58007581-58007603 CACATTAAAGAAACACACAATGG - Intergenic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069437993 10:68403209-68403231 AAGAAAAAAAAAACAGAAAAGGG + Intronic
1069947334 10:71997025-71997047 CACAATAAATAAATAAACAACGG - Intronic
1070053459 10:72911691-72911713 CAGTAGAAACCAACAGAAAAGGG - Intronic
1070455955 10:76615730-76615752 AAGAAAAAAAAAACAGACATTGG + Intergenic
1070468133 10:76745970-76745992 CAGAATAAAGAAACAAGGAATGG + Intergenic
1070658774 10:78289915-78289937 CAGAAACAACAAACAGAAAAAGG + Intergenic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1071634668 10:87239785-87239807 CCTAATAAACAAACAAATAATGG + Intergenic
1071699363 10:87913666-87913688 CAGAATAAAAAGAGAGAAAAGGG - Intronic
1071776263 10:88791776-88791798 CAGAAAAAAAAAATAGAGAAGGG - Intergenic
1071985381 10:91045075-91045097 CAGTATCAACAACCAGACACAGG - Intergenic
1072103388 10:92250686-92250708 CAAAACAAACAAACAAAAAATGG - Intronic
1072186183 10:93041377-93041399 ATAAATAAACAAACAAACAAGGG - Intronic
1072646370 10:97258186-97258208 AAGACTAAACAAACAAAAAATGG + Intronic
1072692320 10:97580181-97580203 CAAAACAAAAAAACAGACCAGGG + Intronic
1073196603 10:101696155-101696177 CAGGATAAACAGACAGAAATTGG - Intergenic
1073365693 10:102938959-102938981 TAAAATAAACAAGCAGACAAAGG + Intronic
1073930845 10:108574220-108574242 CAGATAAAACACACACACAAGGG + Intergenic
1074207358 10:111295299-111295321 TAAACTCAACAAACAGACAATGG - Intergenic
1075059747 10:119247642-119247664 CAAAACAAACAAACAAACAAAGG - Intronic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075154076 10:119959477-119959499 CTAAATAAACAAACAAACAAAGG - Intergenic
1075551667 10:123397215-123397237 CAGGGAAAACACACAGACAAAGG - Intergenic
1076592387 10:131593005-131593027 CACAATTAAAAAATAGACAAAGG - Intergenic
1076592704 10:131597705-131597727 CACAATTAAAAAATAGACAAAGG - Intergenic
1076753703 10:132557046-132557068 CAAAAGAAACACACACACAAAGG - Intronic
1076972281 11:142659-142681 AAGAAAAAAAAAACAGATAATGG + Intergenic
1077003652 11:338933-338955 CAGAATATACAAACAAAGGAAGG - Intergenic
1077396119 11:2323025-2323047 CAGAGTAAACACACAGCCTAAGG + Intergenic
1078127201 11:8579067-8579089 CAGAATAAGAAAAAAGAAAAAGG - Intronic
1078498978 11:11850519-11850541 CAAAGCAAACAAACAGAAAAAGG - Intronic
1078528357 11:12117856-12117878 CAGAATAGAGAAACACACAAGGG + Intronic
1078825433 11:14925503-14925525 CATAATAAACAATCAGAAGATGG + Intronic
1079064093 11:17274826-17274848 CAAAACGAACAAACAAACAAGGG - Intronic
1079248621 11:18771471-18771493 CAGAACAAAGTAAGAGACAAAGG - Intronic
1079473684 11:20806420-20806442 GAAAAGAAACAAACATACAATGG - Intronic
1079840287 11:25388617-25388639 CAGATTAAACAAATAGACTGAGG - Intergenic
1079880217 11:25918491-25918513 CAGACTAAATAATCTGACAATGG - Intergenic
1080237363 11:30086618-30086640 AAAAATATACAAACAGACAATGG - Intergenic
1080570244 11:33549353-33549375 TTAAATAAACAAACAAACAAAGG - Intronic
1081064699 11:38526174-38526196 CAGTAAAAAAAAAAAGACAAAGG + Intergenic
1081086139 11:38803824-38803846 CAGAAAAAAAAAAAAGAAAAGGG + Intergenic
1081501014 11:43666503-43666525 CAAAACAAACAAACAAAAAATGG - Intronic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1081902424 11:46640316-46640338 CTGAATATACTAACAGACAGTGG - Intronic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1082925991 11:58547984-58548006 CACATGAAACAAACATACAAAGG + Intronic
1083121420 11:60516277-60516299 CAGACTAAACCAACACACACAGG + Intronic
1084316737 11:68349996-68350018 CTGAATGAACTAACAGGCAAAGG - Intronic
1084523588 11:69682129-69682151 CAAAATACAGAAACATACAAAGG - Intergenic
1084799603 11:71534061-71534083 CAAAACAAACAAACAAACAAAGG - Intronic
1085520450 11:77135913-77135935 CAAAACAAACAAACAAACATAGG - Intronic
1085597312 11:77821296-77821318 GAGAATTAATAAACAGAAAAAGG + Intronic
1085879265 11:80446358-80446380 AAGAATAAACAAAAAGACTGTGG - Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086719613 11:90104346-90104368 ATGAATAAACAAGCAAACAAAGG + Intergenic
1086800728 11:91171431-91171453 AAAAACAAACAAACAAACAAAGG + Intergenic
1086856602 11:91873181-91873203 GAGAGGAAGCAAACAGACAAGGG - Intergenic
1086886008 11:92206290-92206312 CAGAATAAAACAACAAAAAAAGG - Intergenic
1087501996 11:98968178-98968200 CATAAAAAACAAATAGAAAAAGG - Intergenic
1087698985 11:101414040-101414062 CAGCAAAAACCAACAGAGAAAGG - Intergenic
1087749203 11:101988040-101988062 CAGAATAAACAGACCCAGAAAGG + Intronic
1087923890 11:103897584-103897606 AAGAAGAAACAAACAAAAAAAGG - Intergenic
1088092573 11:106060144-106060166 CAGAAAAAAAAAACAAAAAAAGG - Intronic
1088129741 11:106472952-106472974 ATGAATAAACCAACAAACAAAGG + Intergenic
1088199936 11:107321228-107321250 CAGAATAAACCCTCAGAGAAGGG + Intergenic
1088212539 11:107472709-107472731 CAGAATGACCAAACGGACAGAGG + Intergenic
1088631081 11:111774389-111774411 CAAAACAAACAAAAAGGCAAGGG + Intergenic
1088834354 11:113565362-113565384 ACAAACAAACAAACAGACAAAGG - Intergenic
1088902862 11:114131634-114131656 CAGAATAAACAATCCGAGAGGGG + Intronic
1088949054 11:114546814-114546836 CAAAAGAAGCAAACAAACAAAGG + Intronic
1089660951 11:119984917-119984939 AAGAGAAAAGAAACAGACAAGGG - Intergenic
1090343333 11:126045409-126045431 AAGAATCAAAAAACAGACAAAGG + Intronic
1090743997 11:129692316-129692338 CATAATAAATAAAGAGATAAAGG - Intergenic
1090992114 11:131827175-131827197 CAAAATCAACAAACATAAAATGG + Intronic
1092249989 12:6889078-6889100 CAAAACAAACAAACAAAAAACGG - Intronic
1092341654 12:7681703-7681725 TAAAACAAACAAACAAACAAAGG - Intergenic
1092701137 12:11232154-11232176 CTGAATAATCAAACAAATAATGG + Intergenic
1092703893 12:11263230-11263252 TACAATAAACATACAGATAAAGG - Intergenic
1092809207 12:12256506-12256528 CAAAACAAACAAACAAACATAGG + Intronic
1093317980 12:17675376-17675398 CAAAATTAACGAAAAGACAAGGG + Intergenic
1093384656 12:18537461-18537483 CATGATAAAAAAACTGACAAAGG + Intronic
1093491139 12:19705989-19706011 CAGAATAAACAGACAACCTACGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093855286 12:24094348-24094370 CATAATAGCAAAACAGACAAAGG - Intergenic
1093917558 12:24822777-24822799 CATACTAAACAAAGAAACAAAGG - Intronic
1093988610 12:25565342-25565364 CAGAATAAGAAAACAGATAATGG - Intronic
1094001946 12:25705196-25705218 CTGAATATTCAAACAGCCAATGG + Intergenic
1094019127 12:25895634-25895656 CAGAATGAACAGAGAGAGAAGGG + Intergenic
1094318244 12:29155537-29155559 AAGAATAAACAAAAAGGCAGGGG - Intronic
1094443611 12:30506386-30506408 AAGAAGAAAAAAAAAGACAAAGG + Intergenic
1094593106 12:31839664-31839686 CAAAACAAACAAACAAACAAAGG - Intergenic
1095232985 12:39764118-39764140 CAAAAAAAAAAAACAGAAAATGG - Intronic
1095407475 12:41882752-41882774 CAGAATAAAATAATATACAATGG - Intergenic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095609173 12:44107979-44108001 GAAAATAAACAAACATACAAAGG - Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1096076127 12:48806159-48806181 GCTAATAAACAAGCAGACAAAGG + Intergenic
1096928614 12:55177858-55177880 GAGAATACACAAACAAATAATGG - Intergenic
1097124076 12:56759472-56759494 CATAATAAACAAAAGGAGAATGG + Intronic
1097181539 12:57174763-57174785 CCAAACAAACAAACAGGCAAGGG + Intronic
1097314211 12:58154831-58154853 CTGAAATAACAAACAGAGAAAGG - Intergenic
1097445201 12:59662078-59662100 CAGAAAACACAAAAAAACAAAGG - Intronic
1097461875 12:59872192-59872214 CAGAATAAACTAACAGAATAAGG + Intergenic
1097513442 12:60571951-60571973 AAGAATGGACAAACAGAAAAAGG + Intergenic
1097674495 12:62583975-62583997 CAAAAAAAAAAAACAGACAGTGG + Intronic
1098025586 12:66197915-66197937 AAAAAAAAACAAACAGAGAATGG + Intronic
1098424271 12:70341512-70341534 CAGAATAAATAAATAAACAATGG - Intronic
1098432997 12:70440764-70440786 AAAAACAAACAAACAAACAAAGG + Intergenic
1098478339 12:70932393-70932415 AATAAAAAACAAACAGAAAAAGG - Intergenic
1098526245 12:71490249-71490271 CAGTATGAACTAACAGAAAAGGG - Intronic
1098757330 12:74382299-74382321 CATAATGAACAAATAGAAAATGG - Intergenic
1098941683 12:76544078-76544100 CAGAATTAACATACAAATAAAGG + Intronic
1099023481 12:77436016-77436038 CAAAACAAACAAACAAACACAGG - Intergenic
1099121169 12:78690803-78690825 CAATATAAACATACAGACATAGG - Intergenic
1099131335 12:78836001-78836023 CAAAATAAGCAAATAGAGAATGG + Intergenic
1099253434 12:80286722-80286744 CACAATAAAAAAAATGACAAAGG - Intronic
1099479403 12:83147503-83147525 CTGAATCAACAGACAAACAAGGG - Intergenic
1099676608 12:85768845-85768867 CAGAATAAACCAACATTTAAAGG + Intergenic
1100925563 12:99543794-99543816 CAGAATAGACAAATTGATAAAGG + Intronic
1101172361 12:102111075-102111097 AAGAATGAATAAACAGACTATGG + Intronic
1101350195 12:103923023-103923045 CAAAAAAAACAAAAAAACAAAGG - Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102004931 12:109583080-109583102 AAGAAAAAAAAAACAGACCAAGG - Intronic
1102641657 12:114372295-114372317 CAAAAGAAAAAAACCGACAATGG - Intronic
1103648938 12:122418052-122418074 AAGAAAAAACAATCAGAGAAGGG - Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104360487 12:128128464-128128486 CACAATCAAGAAACAGAAAATGG - Intergenic
1105796069 13:23854325-23854347 CAAAATAAACAAATAGGAAATGG - Intronic
1106359943 13:29021800-29021822 TTGAATAAACAAAGACACAAGGG + Intronic
1106662033 13:31809858-31809880 CAGAAGAAGAAAAAAGACAAGGG + Intergenic
1106688545 13:32088853-32088875 GAGAATACAAAACCAGACAAAGG + Intronic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107034902 13:35891809-35891831 GAGAATAAACAAAGAGGGAAGGG - Intronic
1107387208 13:39924978-39925000 AAGAATATACAAATATACAAGGG - Intergenic
1107399080 13:40051112-40051134 CAGAAAATAAAAACAGGCAAAGG - Intergenic
1107832021 13:44383010-44383032 AAGAACAAACAGCCAGACAAAGG + Intronic
1107993735 13:45840908-45840930 CAGAATATCAAAACAGAAAAAGG - Intronic
1108331348 13:49387869-49387891 CAGAATAACAATACAGAAAATGG + Intronic
1108374630 13:49802503-49802525 CAAAACAAACAAACAAAAAAAGG + Intergenic
1108814931 13:54278668-54278690 CAGAGTAAACAGACAACCAATGG - Intergenic
1109087067 13:57987106-57987128 CAAAATAAACAATCAGTAAAGGG + Intergenic
1109418635 13:62079164-62079186 CAGAATAAAAAGAAAGAGAATGG - Intergenic
1109455695 13:62585722-62585744 AAAAATGAACAAACAAACAAAGG + Intergenic
1109509337 13:63349558-63349580 CAAAATAAGCAAACAAACATGGG + Intergenic
1110661716 13:78065515-78065537 CCGAATATGCAAACAGACAGTGG + Intergenic
1111394886 13:87652498-87652520 AAGAATAAACAGACCAACAAAGG - Intergenic
1111534701 13:89587778-89587800 CAAAATAAACTAAAGGACAAAGG - Intergenic
1111581538 13:90230069-90230091 TAAAACAAACAAACAAACAAAGG + Intergenic
1111601360 13:90479601-90479623 CAGAAAATACAAACACACACTGG - Intergenic
1111691666 13:91571016-91571038 CAGACTGAACTATCAGACAAGGG - Intronic
1111767507 13:92550886-92550908 AAAAATAAACAAACAAACCAAGG - Intronic
1111767556 13:92551764-92551786 AAGAACAAACAAACAGAAAAAGG + Intronic
1112268724 13:97949265-97949287 AAGAAAAAAAAAACAGACAATGG + Intergenic
1112353996 13:98659646-98659668 AAGAAAAAACAAACAAACAAAGG - Intergenic
1112735200 13:102408479-102408501 CAGAATAAACAGACAACCTACGG - Intergenic
1112800137 13:103101286-103101308 CAGATTTAAAAAACAGATAAAGG + Intergenic
1112938469 13:104830224-104830246 AAGAAAAAACAAAAAGACACGGG - Intergenic
1113086413 13:106573787-106573809 AAAAACAAACAAACAAACAAGGG + Intergenic
1113096685 13:106672841-106672863 CATAATAAACAATAAGACAGAGG - Intergenic
1113140327 13:107141077-107141099 CAAAAAAAAAAAACAGTCAATGG + Intergenic
1113296843 13:108968626-108968648 CAAAAGAAAAAAAAAGACAATGG + Intronic
1113647380 13:112008442-112008464 CAGCATCAGCAAACAGACAGGGG + Intergenic
1114169308 14:20255807-20255829 CTGAATAAATAAACAGAAAAGGG + Intergenic
1114172734 14:20289748-20289770 TAGAAAAGACAGACAGACAAAGG + Intronic
1115148512 14:30255507-30255529 CAGAATAAACAGACAACCTATGG - Intergenic
1115512129 14:34147897-34147919 AAAAACAAACAAACAAACAAAGG + Intronic
1115918568 14:38345057-38345079 AATAAAAAACAAACATACAATGG + Intergenic
1116031190 14:39574542-39574564 CAAACTACACAAAGAGACAAAGG - Intergenic
1116106200 14:40510790-40510812 CAGAATAAAAAATCAGCAAAAGG + Intergenic
1116233162 14:42243744-42243766 TCAAATAAACAAACAAACAATGG + Intergenic
1116330697 14:43594193-43594215 CAAAAAAAAAAAAAAGACAAAGG - Intergenic
1116343105 14:43752177-43752199 CAGAAAAAACAAACTCAAAATGG + Intergenic
1116442928 14:44975459-44975481 CAAAACAAACAAACAAAAAAAGG - Intronic
1116596453 14:46853688-46853710 CACAATAAACAAAAATACCAAGG - Intronic
1116809803 14:49528273-49528295 CAGGTCTAACAAACAGACAAGGG + Intergenic
1117091020 14:52250307-52250329 TTGAATAAACAACCAGACACAGG + Intergenic
1117291509 14:54338555-54338577 CAGAACAACCAAACAAACAATGG - Intergenic
1118086405 14:62423042-62423064 AAGAAAAGAAAAACAGACAAAGG + Intergenic
1118294793 14:64559088-64559110 AAAAATAAATAAACAGAGAAAGG + Intronic
1118417224 14:65554249-65554271 CAAAATACAAAAACAGATAAGGG - Intronic
1119885766 14:78140148-78140170 TAGAAGAAACAAGCAGACCATGG - Intergenic
1119983758 14:79112441-79112463 CAGAAGGAAGGAACAGACAAGGG - Intronic
1120130242 14:80798342-80798364 CAAAATAAGCAAAGAGAAAAAGG + Intronic
1120165841 14:81198596-81198618 CAGAATAAAAAACCAGAGAATGG - Intronic
1120226246 14:81793903-81793925 CAAATTAAAAAAACAAACAAGGG - Intergenic
1120290071 14:82556929-82556951 CAGGATATACAAAAAGCCAATGG - Intergenic
1120351178 14:83360704-83360726 GAGAATAAACATAAAGACAATGG - Intergenic
1121207707 14:92183119-92183141 ACGAACAAACAAACAAACAAAGG - Intergenic
1121403145 14:93700112-93700134 CAATATAAGCAAAAAGACAATGG - Intronic
1121419334 14:93801535-93801557 CAGAAAAAAGGAACAGAGAAAGG + Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121623524 14:95367871-95367893 TAAAATAAAAAGACAGACAAAGG - Intergenic
1122318190 14:100837863-100837885 GAGCAGAAACAAGCAGACAAAGG - Intergenic
1122820266 14:104340147-104340169 AAAAACAAACAAACAAACAAAGG + Intergenic
1123828907 15:24113341-24113363 ATGTATAAACAAACAGAAAAGGG - Intergenic
1124121105 15:26889365-26889387 CAGAAAAAAAAAAAAGACAGTGG - Intronic
1125260150 15:37814213-37814235 CAGAATAAAGCAACAGCCTATGG + Intergenic
1125334027 15:38610052-38610074 GAGGATAAAGACACAGACAATGG - Intergenic
1125358804 15:38844495-38844517 CAGAGTATACACACAGACACAGG + Intergenic
1126412232 15:48384203-48384225 CAGAATGAAGAAACTGATAATGG + Intergenic
1126553235 15:49955630-49955652 ATGAATAGACAAACAGATAAGGG + Intronic
1126593099 15:50359300-50359322 CACAAAAAACAAACAAAAAAAGG - Intergenic
1127622520 15:60747722-60747744 CAGAATATGCAAACAGGCCATGG + Intronic
1127813841 15:62589050-62589072 CAGAATAAACATCCAGATACAGG - Intronic
1128021932 15:64399276-64399298 CAGAATAAGCTGATAGACAATGG + Intronic
1129068196 15:72927624-72927646 CAGAGTAAAGTAACAGACACTGG - Intergenic
1129767261 15:78178282-78178304 CAAAACAAACAAACAAAAAAAGG - Intronic
1129872848 15:78952144-78952166 CATAGTAAACAAGCAAACAAGGG + Intergenic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1130003106 15:80065025-80065047 CAAAACAAAAAAACAGGCAAGGG + Intronic
1130049866 15:80474901-80474923 CAGAATAAATATGCAGATAAAGG + Intronic
1130442531 15:83969449-83969471 AAAAACAAACAAACAAACAATGG + Intronic
1131570124 15:93526138-93526160 CAGAGTAAACAAAAATAGAAGGG - Intergenic
1131898633 15:97062569-97062591 CAAAACAAACAAACAAAAAAAGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1132913400 16:2327707-2327729 CAGAAAAAAGAAAAAGAAAATGG - Intronic
1133012277 16:2920569-2920591 AAAAACAAACAAACAAACAATGG - Intronic
1133410031 16:5560529-5560551 CAGGAGATTCAAACAGACAAAGG - Intergenic
1133846647 16:9460471-9460493 GAGAATAAAAAAAGAGAGAAAGG - Intergenic
1134303828 16:13014366-13014388 CAGAAAAAACAAAAAGGGAAGGG - Intronic
1134444159 16:14318204-14318226 CAGAATAAACAAATCCACAGGGG - Intergenic
1134673572 16:16073754-16073776 CTCAAAAAACAAACAAACAAAGG + Intronic
1134745774 16:16587217-16587239 AACAATAAATAAACAGAGAATGG - Intergenic
1134765879 16:16757570-16757592 CAGAGTAAAATAACAGACACTGG + Intergenic
1134980171 16:18601644-18601666 CAGAGTAAAATAACAGACACTGG - Intergenic
1134999707 16:18766525-18766547 AACAATAAATAAACAGAGAATGG + Intergenic
1135492187 16:22919101-22919123 CAAAACAAACAAACAAAAAACGG + Intergenic
1135815525 16:25629060-25629082 CAAAACAAACAAACAAAAAAAGG - Intergenic
1136496636 16:30649165-30649187 CAAAACAGACAAACAAACAAGGG - Intergenic
1137379562 16:47984727-47984749 AACAAAAAACAAACAAACAAAGG + Intergenic
1137851263 16:51747152-51747174 AAAAATAAACAAACAGACAAAGG + Intergenic
1138047350 16:53739126-53739148 AAGATTAAAAAGACAGACAAGGG - Intronic
1138318900 16:56094184-56094206 CAGAACAAACAAACAAAAAAGGG + Intergenic
1138515175 16:57531985-57532007 GACAATAAACAAACAGCAAATGG - Intronic
1138525564 16:57604278-57604300 CTCAAAAAACAAACAAACAAAGG - Intergenic
1138565404 16:57829247-57829269 AAAAACAAACAAACAAACAAAGG - Intronic
1138684521 16:58713154-58713176 AAGAAAAAACAAACAAACAATGG + Intronic
1138853852 16:60663405-60663427 CAAAACAAACAAACAAAAAAAGG + Intergenic
1139075015 16:63435046-63435068 CAGAAAAGAGAAAGAGACAAAGG + Intergenic
1139108491 16:63858960-63858982 CAGAATAAACAAATAATAAATGG - Intergenic
1140101305 16:71919838-71919860 CAAAATAATCACACAGATAAAGG - Intronic
1140208094 16:72949758-72949780 AAGAAAAAAAAAACACACAAAGG + Intronic
1140336595 16:74112732-74112754 CAGAATAGAGTAACAGACATTGG + Intergenic
1140511264 16:75510189-75510211 AAGAAAAAAAAAACAGACATTGG - Intergenic
1141092915 16:81142468-81142490 CAAAAAAAACAAAAAAACAAAGG - Intergenic
1141407057 16:83804050-83804072 CACAAAAAACAAATAGAAAATGG - Intergenic
1142394455 16:89823944-89823966 AAAAACAAACAAACAGAAAAAGG - Intronic
1142459520 17:80461-80483 AAGAAAAAAAAAACAGATAATGG + Intergenic
1142523676 17:522721-522743 CAGAACAAACAAAGAGGAAAAGG - Intronic
1142934363 17:3315630-3315652 CAGAATAAACAGACAACCTATGG - Intergenic
1143482112 17:7233747-7233769 CGTACTAAACAACCAGACAATGG + Intronic
1144060662 17:11581123-11581145 CTGAATATGCAAGCAGACAATGG + Intergenic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1144148066 17:12417207-12417229 AAGAATAAACAAGCAAACAAAGG + Intergenic
1144185665 17:12792933-12792955 CAGACTAAGGAAACAGACCAAGG - Intronic
1144314663 17:14048470-14048492 CAGAAAAAAAAAAAAGAAAAAGG - Intergenic
1145095300 17:20020320-20020342 AAAAATAAAAAAACAGAGAAAGG - Intronic
1146516169 17:33491240-33491262 CAGAACACACACACAGACAATGG + Intronic
1147290437 17:39437952-39437974 AAAAATAAAAAAACAGAAAAGGG + Intronic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1148348245 17:46918794-46918816 CATAATGCACAAAAAGACAAAGG - Intergenic
1148349417 17:46928960-46928982 AAGTATAAACAAACAGAAAGAGG - Intronic
1148424661 17:47583584-47583606 CAGAAAAAAAAAAAAGAAAAAGG + Intronic
1148878777 17:50708932-50708954 CATACTAAACAAACAGACATTGG - Intergenic
1149509011 17:57222036-57222058 CAGAATAAACAACCAAATTATGG + Intergenic
1149580153 17:57744299-57744321 CAGAAAGACCATACAGACAAGGG + Intergenic
1149883507 17:60316843-60316865 AAAAACAAACAAACAAACAAAGG + Intronic
1150386888 17:64768723-64768745 CCCAATACACAAACAGGCAAAGG + Intergenic
1150565039 17:66331263-66331285 CAGAAGAGAAAAACAGACGAAGG - Intronic
1150641075 17:66949900-66949922 CAGAATAAAAACACAGAAAGAGG - Intergenic
1150764122 17:67989672-67989694 AAAAACAAACAAACAAACAAAGG - Intergenic
1150858564 17:68776986-68777008 CACAAAAAAAAAACAGAAAATGG - Intergenic
1151045124 17:70910909-70910931 CTGAATTAATAAACGGACAAAGG + Intergenic
1151798650 17:76364102-76364124 CAAAATTCACAAACAAACAAAGG - Intronic
1152681141 17:81668687-81668709 ATAAATAAACAAACAAACAAAGG - Intronic
1153147224 18:2047260-2047282 CAGAATAAACTCATATACAAGGG + Intergenic
1153324987 18:3809391-3809413 TAAAACAAACAAACAAACAAAGG + Intronic
1153627363 18:7034413-7034435 ATGAATAAACAAACATAAAATGG + Intronic
1153783988 18:8517962-8517984 CAGAACAAAAAAATGGACAAAGG + Intergenic
1154128275 18:11713618-11713640 CTGAATATATAAACAGGCAATGG - Intronic
1154936973 18:21070614-21070636 CTAAAGAAACAAACAAACAATGG + Intronic
1155012863 18:21798950-21798972 AAGAATAAACAAAAAGGCAGAGG - Intronic
1155513934 18:26605074-26605096 AAGGAAAAAGAAACAGACAAAGG + Intronic
1155854317 18:30813761-30813783 CAGATTATGAAAACAGACAAGGG + Intergenic
1155894275 18:31304022-31304044 AAGAATATCCAAACAGACTATGG - Intergenic
1156303126 18:35852917-35852939 CAGACTATACAAGCAGACAATGG - Intergenic
1156818885 18:41345388-41345410 CAGAGTACACACACACACAATGG + Intergenic
1157015255 18:43704406-43704428 TTGAATATACGAACAGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157165065 18:45351349-45351371 CAAAACAAACAAACAAAAAACGG - Intronic
1157448002 18:47761217-47761239 AAAAATAAATAAACAAACAAAGG + Intergenic
1158361328 18:56677348-56677370 CAAAATAAACAAGCAAACAATGG - Intronic
1158547772 18:58410590-58410612 CTGAATAAACAGTCAGACACTGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159056978 18:63476064-63476086 CAAAAGAAACAAAAAGAAAAAGG - Intergenic
1159159613 18:64626261-64626283 CAACATAAAGAAACAAACAACGG + Intergenic
1159159688 18:64627843-64627865 CCAAACAAACAAACAAACAAAGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159807861 18:72977285-72977307 CAGCATAAATAAACCAACAAAGG + Intergenic
1160061276 18:75531432-75531454 GAAAACAAACAAACAAACAAAGG - Intergenic
1160099334 18:75905423-75905445 AAGAATAAACAAACAAACGTTGG - Intergenic
1160210536 18:76874584-76874606 CAGAAAAATCAAGCAGAGAAGGG + Intronic
1160465832 18:79075052-79075074 AAGAATAAACAAAGTCACAAGGG - Intronic
1160658032 19:283585-283607 CAGACTAACCAAACAGGCCAGGG + Intronic
1160964010 19:1737813-1737835 CAAAAAAAAAAAACAGACACAGG + Intergenic
1161544760 19:4873651-4873673 AACAAAAAACAAACAAACAAAGG + Intergenic
1161824971 19:6557308-6557330 CAGAAAAAAAAAACAGGCCATGG - Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1161929242 19:7325405-7325427 GAGAATAAATAAACATACTATGG + Intergenic
1162578260 19:11512032-11512054 AAAAAAAAACAAACAAACAAAGG + Intronic
1163120048 19:15212014-15212036 AACAAAAAACAAACAAACAAAGG + Intergenic
1164140750 19:22460221-22460243 AAAAACAAACAAACAAACAAAGG - Intronic
1165243801 19:34486355-34486377 AAAAAAAAACAAACTGACAAAGG - Intronic
1166008893 19:39926765-39926787 CAGAACAAACCAACAGACAGGGG + Intronic
1166196802 19:41211776-41211798 GAAAACAAACAAACAAACAAAGG + Intergenic
1167869117 19:52352932-52352954 AAAAATAAACAAACAAATAAAGG - Intronic
1167921011 19:52783358-52783380 CAAAACAAACAAACAAAAAAAGG - Intronic
1168235078 19:55057790-55057812 AATAATAAACAAAAAGAAAAGGG - Intronic
1168359307 19:55725500-55725522 CAGAATCAAAACACAGATAAGGG + Intronic
1168585264 19:57586568-57586590 CAAAACAAAAAAACAGAAAAGGG + Intronic
1202641568 1_KI270706v1_random:95387-95409 CAGATTAACCAAACAAAGAAAGG - Intergenic
925244441 2:2368102-2368124 ACAAATAAACAAACAAACAAGGG + Intergenic
925392348 2:3504937-3504959 CAGAAAATACAAACATACACAGG - Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
925489027 2:4371172-4371194 CAAAAAAACCACACAGACAAAGG + Intergenic
925571553 2:5317433-5317455 CAAAACAAGCAAACAGAAAATGG + Intergenic
925735271 2:6958317-6958339 CAGAACAGACACACGGACAAGGG + Intronic
925853188 2:8104180-8104202 CTGAAAACACAAACAGGCAACGG + Intergenic
926110370 2:10179149-10179171 CAAAACAAACAAACAAAAAAAGG - Intronic
926588388 2:14714314-14714336 CACAAAAAACAAACTGAGAAGGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927747636 2:25635920-25635942 AAGGATAGACAAACAGACCAGGG + Intronic
927794755 2:26038186-26038208 AAAAAAAAACAAACAAACAAAGG - Intronic
927995212 2:27480367-27480389 CAGAGAAAACAAAAAGACCAGGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928243179 2:29604359-29604381 CAGAAAAAAGAAGCAGAGAAGGG + Intronic
928248920 2:29657576-29657598 CTGAATTAACAAACACAAAATGG + Intronic
928652319 2:33416310-33416332 CAGAATAAACCTAAAGAAAATGG - Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929238569 2:39629954-39629976 GAGAACAAAGAAACAGAGAATGG - Intergenic
929742952 2:44623265-44623287 CAGAGTAAACAGACAGCCTACGG - Intronic
929924890 2:46199934-46199956 CTCAAAAAACAAACAAACAAAGG + Intergenic
930406955 2:50970556-50970578 CAGAATAACCAAACACTCAAAGG + Intronic
930526869 2:52541508-52541530 GAGAATAGACTGACAGACAAGGG - Intergenic
930783462 2:55247254-55247276 AAGTATAAAACAACAGACAAGGG + Intronic
930882349 2:56286313-56286335 CAGAAAAAGAAAAGAGACAATGG - Intronic
930963787 2:57294824-57294846 CAGAATAAAATAACAGATATAGG + Intergenic
931023784 2:58084063-58084085 CAGACAAAAAAAACACACAATGG - Intronic
931117828 2:59183665-59183687 TAAAACAAACAAACAAACAAAGG + Intergenic
931334453 2:61325062-61325084 CAGATGAAACTAACAGACACTGG + Intronic
931466572 2:62493022-62493044 CAAAACAAACAAACAAACGAAGG - Intergenic
931547303 2:63403240-63403262 AAGAAGAAAAAAACAGACACTGG + Intronic
931824301 2:65983877-65983899 AAGAACAAACCAACAGAGAAAGG - Intergenic
932252925 2:70259814-70259836 CAAAAGAAAAAAAAAGACAATGG - Intronic
932272026 2:70419273-70419295 AAAAACAAACAAACAAACAAAGG + Intergenic
932659774 2:73642035-73642057 CAGAAAAAGGAAACAGAAAAAGG - Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
934086540 2:88514584-88514606 CAGAATAAAAAAGCAGAAAAAGG + Intergenic
935315329 2:101827811-101827833 CAGAATAAAAGAGCAGGCAAAGG - Intronic
935440050 2:103082446-103082468 ATGAACAAACAAACAAACAAAGG + Intergenic
935515580 2:104033624-104033646 GCAAATAAACAAACAAACAAAGG + Intergenic
935519301 2:104084405-104084427 AAGAATAAACAAGTAGACCAAGG - Intergenic
935677981 2:105612347-105612369 CCGAATAAACAAACCCACAAAGG - Intergenic
936862729 2:117037083-117037105 CAGAGTAAACAGACAGCCTATGG + Intergenic
937285635 2:120749163-120749185 AAGCACAAATAAACAGACAATGG - Intronic
937447836 2:121973852-121973874 CAGAGTAAACAGACAGCCTAAGG + Intergenic
937548551 2:123056872-123056894 GAGAATAAACTAACATACACAGG - Intergenic
937609507 2:123843010-123843032 CAGAAAAAGAAAAAAGACAAAGG + Intergenic
937704850 2:124908402-124908424 CAAAACAAAAAAACAGAAAAAGG + Intronic
937943798 2:127312660-127312682 CAAAATAAAAAAACAAACAAAGG + Intronic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938816788 2:134912900-134912922 TCAAACAAACAAACAGACAAAGG - Intergenic
939059395 2:137401311-137401333 CACACAAAACAAACACACAAAGG - Intronic
939195941 2:138972347-138972369 TAAAACAAACAAACAAACAAAGG - Intergenic
939368567 2:141267195-141267217 GAGAATAAACTAAGACACAATGG + Intronic
939892445 2:147753349-147753371 AAGAATTAACAAAGAGACATTGG + Intergenic
939893249 2:147762353-147762375 AAGTATAAACAAACAAACAAAGG - Intergenic
939917075 2:148059845-148059867 CAAAAAAAAAAAAAAGACAAAGG + Intronic
940666240 2:156613739-156613761 CAGAAAAAAAAAACTGAAAATGG - Intergenic
940677583 2:156744058-156744080 AAAAACAAACAAACAAACAAAGG - Intergenic
941420328 2:165276144-165276166 CAAAACAAACAAACAAAAAAAGG - Intronic
941426493 2:165352178-165352200 TGGATTAAAAAAACAGACAAAGG - Intronic
941727798 2:168882750-168882772 CCTAAGAAAAAAACAGACAAAGG + Intronic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941947024 2:171110468-171110490 AAAAATAAACAAACAGAAAATGG + Intronic
942759447 2:179381155-179381177 CAGAATTTACAAACAGCAAAAGG + Intergenic
943118263 2:183702222-183702244 TAGAATAAAAAAACAGTCATAGG + Intergenic
943143297 2:184010346-184010368 CAGACAAAACAAAAAGGCAAAGG + Intergenic
943242403 2:185402009-185402031 AAAAATAAGCAAAGAGACAAGGG + Intergenic
943248652 2:185488735-185488757 AAGAAATAAAAAACAGACAAAGG - Intergenic
943976133 2:194480237-194480259 CAAAATAAACAAGCAAACAAAGG - Intergenic
944189566 2:196987402-196987424 CAGAATATACAAATATAAAAAGG + Intronic
944213777 2:197233477-197233499 CAAAATTAACAAAGGGACAAAGG + Intronic
945204412 2:207316721-207316743 CATAAATAACAAACAGAGAAAGG + Intergenic
945228758 2:207561325-207561347 CAGAATTAAGCAACAGACTAAGG - Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945752308 2:213803468-213803490 CAGAAGAGACAGAAAGACAATGG - Intronic
945824830 2:214708828-214708850 CAGAAAGAACAAACACAAAATGG - Intergenic
946635348 2:221719016-221719038 CTGCATATACAAGCAGACAATGG + Intergenic
947061797 2:226175206-226175228 AAAAACAAACAAACAAACAAAGG + Intergenic
947562278 2:231166501-231166523 TAGAAAAAAAAAAAAGACAACGG - Intronic
947829878 2:233131698-233131720 TCAAATAAACAAACAAACAAAGG + Intronic
948485893 2:238280603-238280625 CAGAATCAATAAAAAGAAAATGG + Intronic
1168731702 20:88210-88232 CAGAATCTACAAACTGTCAATGG - Intronic
1168920874 20:1534932-1534954 CAAAAGAAACAATCAGACAAGGG + Intronic
1169296662 20:4405850-4405872 CAGAATGAGCATTCAGACAAAGG + Intergenic
1170131899 20:13029845-13029867 CCTAATAAACACACAGAGAAGGG + Intronic
1170449699 20:16469947-16469969 CAAAACAAACAAACAAAAAAGGG + Intronic
1170468671 20:16646605-16646627 CAGAAGGAACATCCAGACAAAGG - Intergenic
1170649840 20:18229239-18229261 CAAAAAAAACAAACAAAAAAAGG + Intergenic
1170712050 20:18800141-18800163 CACAATAAAAAAATATACAAAGG - Intergenic
1171952202 20:31430403-31430425 CAAAACAAACAAACAAACAAAGG - Intergenic
1172135683 20:32685134-32685156 CAAAAGAAAAAAACAAACAAAGG + Intergenic
1172268969 20:33642098-33642120 CACAAAAAAAAAAAAGACAAAGG - Intronic
1173453395 20:43185262-43185284 AAGAATAAGAAAACAAACAAGGG - Intronic
1173619446 20:44425571-44425593 CAGAATAAACAACAAGACACTGG + Intronic
1173745642 20:45434649-45434671 CAAAACAAACAAACAAAAAATGG - Intergenic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173924176 20:46768554-46768576 CAAAACAAACAAACAAAAAATGG + Intergenic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1174179126 20:48664015-48664037 CAGAATGAACAAAGACAGAAAGG + Intronic
1174505397 20:51014558-51014580 CTGAATAAACGAACAAATAAAGG - Intronic
1174714049 20:52737837-52737859 CTAGATAAACAAACAGACAGAGG + Intergenic
1174720912 20:52811404-52811426 CAAAACAAACAAACAAAAAAAGG - Intergenic
1174847521 20:53957498-53957520 CTAAAATAACAAACAGACAATGG + Intronic
1175452552 20:59082103-59082125 AAGAATACATAAACGGACAAAGG + Intergenic
1176304944 21:5118392-5118414 CAGACTAAACAGTCAGGCAAGGG + Intronic
1177382238 21:20359775-20359797 CAAAACAAACAAACAAAAAAAGG + Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178155882 21:29853816-29853838 GACAATAAACAAACATATAAAGG + Intronic
1178363785 21:31971515-31971537 GAGAACATACAAACAGAGAAAGG + Intronic
1178759514 21:35388116-35388138 CAGTATAAACCAGGAGACAATGG - Intronic
1178851980 21:36220065-36220087 CAAAATAAACAAACAAAACAGGG - Intronic
1179852110 21:44143638-44143660 CAGACTAAACAGTCAGGCAAGGG - Intronic
1180360378 22:11886488-11886510 CAGATTAACCAAACAAAGAAAGG + Intergenic
1180899798 22:19362096-19362118 AAAAATAAACAAAGAGACACCGG + Intronic
1181155112 22:20915400-20915422 CAGAATAAAAAAAAAAAAAAAGG + Intergenic
1181529050 22:23505782-23505804 AAGAATGAAAAAACAGATAAGGG - Intergenic
1181684360 22:24518156-24518178 CAGAAAAAAAAAACAGGGAAAGG + Intronic
1181783442 22:25208958-25208980 CTAAATAAACAAACAAACAAAGG - Intergenic
1182884058 22:33758193-33758215 CAGCTTCAGCAAACAGACAAAGG - Intronic
1183021693 22:35032672-35032694 GATAATAAACAAACAAATAAGGG + Intergenic
1183760586 22:39812774-39812796 CAAAACAAAAAAAAAGACAAAGG - Intronic
1184009269 22:41734594-41734616 AAAAACAAACAAACAAACAATGG + Intronic
949192219 3:1263975-1263997 CAGAAGAAACAAGAAGACCAAGG + Intronic
949825894 3:8165571-8165593 CAAAAAAAACAAACAAAAAATGG - Intergenic
949941847 3:9160964-9160986 AAGAATAAACAAACACATAAAGG + Intronic
950289551 3:11772380-11772402 CAGAGTAGAAAAACAGACACTGG - Intergenic
950470857 3:13185405-13185427 CAGAATAAACAAGTAGACAAAGG - Intergenic
950768077 3:15288747-15288769 CAAAACAAACAAACAAAAAAAGG + Intronic
950902522 3:16510912-16510934 CAGAATATACAAACAAACTGTGG + Intronic
950951544 3:17005105-17005127 AGGAATAATCAAACAGAAAATGG + Intronic
951656094 3:25010033-25010055 TATAATAAACAATCAGTCAAAGG - Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952202441 3:31145220-31145242 GAAAATAAACAAAAAAACAATGG - Intergenic
953211244 3:40877136-40877158 CAGTATAAACAAACTCACATTGG - Intergenic
953380526 3:42468114-42468136 TAGATTAAACAAACAGAAAATGG + Intergenic
956134495 3:66085508-66085530 AACAATAAACAAACAAATAATGG - Intergenic
956211409 3:66805264-66805286 TAGAATAAAAAGGCAGACAAAGG - Intergenic
956335019 3:68154082-68154104 CCAAATAAGCAATCAGACAATGG - Intronic
956616115 3:71174421-71174443 AAAAACAAACAAACAAACAAAGG + Intronic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
957413261 3:79867623-79867645 CAGATTAAAAAAAATGACAAAGG - Intergenic
957697776 3:83664801-83664823 AAGGACAAAGAAACAGACAAAGG + Intergenic
957701688 3:83723627-83723649 GAGAACAAACAAACAAAAAAAGG - Intergenic
957903033 3:86521701-86521723 CAGAATATGCAAAAAGACTAGGG - Intergenic
958072463 3:88632094-88632116 CAGAAACAAAAAACAGATAATGG + Intergenic
958095114 3:88934492-88934514 CACAAAAAACAAAGAGACAAGGG - Intergenic
958141307 3:89565385-89565407 TGGAAGAAACAAACAGAGAAGGG + Intergenic
958903635 3:99917952-99917974 AACAAAAAACAAACAAACAAGGG - Intronic
959275414 3:104271312-104271334 CATAAATAACAAACAGAGAAAGG + Intergenic
959312137 3:104752321-104752343 CAGAATAAACAAACTTATATAGG + Intergenic
959857920 3:111181840-111181862 CAAAACAAACACACAAACAATGG - Intronic
960404895 3:117247750-117247772 CTTAATAAACAAATAGATAATGG - Intergenic
960943499 3:122950134-122950156 AAGAATATACATACAAACAAGGG + Intronic
961071526 3:123933496-123933518 CAAAACAAACAAACAAAAAAAGG + Intronic
961140852 3:124554650-124554672 CAAAATAAATAAACAGAAAAAGG - Intronic
961245606 3:125450090-125450112 AAGAAAAAAGAAAAAGACAATGG + Intronic
961576428 3:127840616-127840638 CAAAAAAAAAAAAAAGACAAAGG + Intergenic
962497319 3:135954262-135954284 CAGAATATATAAGGAGACAAGGG - Intergenic
962497325 3:135954318-135954340 CAGAATATATAAGGAGACAAGGG - Intergenic
962894390 3:139700734-139700756 GAGAATAAAAAAGCAGAAAAAGG + Intergenic
962899970 3:139753413-139753435 CAAAATAAACAAATAAATAAAGG + Intergenic
962972760 3:140419876-140419898 CAAAATAAACAAAGAGGTAATGG - Intronic
963050880 3:141142583-141142605 CAGAGTCAACAAAGAAACAATGG - Intronic
963455570 3:145542247-145542269 CAGAGTAAACAAACAACCCATGG - Intergenic
964178407 3:153854661-153854683 ACAAATAAACAAACAAACAAAGG - Intergenic
964266972 3:154909177-154909199 TAATATAAAAAAACAGACAAAGG + Intergenic
964280223 3:155055942-155055964 AAAAACAAACAAACAAACAATGG - Intronic
964386494 3:156153371-156153393 CAGAAGAAACAAACATACAGTGG - Intronic
964484836 3:157176437-157176459 CAGAACAAAAAAACAGAAACAGG + Intergenic
964663553 3:159148284-159148306 CAGAAAACAAAAACAGACATAGG - Intronic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
965013198 3:163124350-163124372 CAAAACAAACAAACAAAAAAAGG + Intergenic
965888522 3:173479356-173479378 CAGAATATATAAACAAACATGGG + Intronic
966000061 3:174938199-174938221 AAGAATAAAGCAACAGACACTGG - Intronic
966132469 3:176657449-176657471 TATAATAAACATACAGAAAATGG + Intergenic
966331434 3:178819131-178819153 TAGAAGAAAAAAACAGAAAAGGG - Intronic
966492523 3:180543816-180543838 CAGAGTAAAATAAGAGACAAAGG - Intergenic
967006296 3:185386111-185386133 CAGAATAAACAGACAATCTACGG + Intronic
967151109 3:186651926-186651948 CAGAATAAACAAGCAAGGAAAGG + Intronic
967310562 3:188102249-188102271 CAGGATAACAAAACTGACAAAGG - Intergenic
967381641 3:188865674-188865696 TACAAAAAAAAAACAGACAATGG - Intronic
967672190 3:192250192-192250214 CAGAATAAACAGAAATAGAAAGG - Intronic
967753258 3:193139332-193139354 CAGGAAAAACAAACATAAAATGG + Intergenic
967921371 3:194616894-194616916 CAAAACAAACAAACAAAAAAAGG + Intronic
968368610 3:198207162-198207184 AAGAAAAAAAAAACAGATAATGG - Intergenic
968805553 4:2769350-2769372 GAGACAAAACAAACAGAAAAAGG + Intergenic
969387663 4:6866114-6866136 GGCAATAAACAAACAGATAAAGG - Intronic
969588526 4:8108368-8108390 CAGACTGAACACACAGACAATGG + Intronic
969852162 4:9966651-9966673 CTAAATAAACAAACAAACACTGG + Intronic
970201601 4:13614405-13614427 AAAAATAAATCAACAGACAAAGG - Exonic
970294431 4:14613636-14613658 GGGAATAAAGTAACAGACAAGGG - Intergenic
970316764 4:14835460-14835482 CTGACTATCCAAACAGACAATGG + Intergenic
970495695 4:16623059-16623081 AGGAATAAATAAAAAGACAAGGG - Intronic
970876662 4:20878533-20878555 GAGAATAAACAAGAAAACAAAGG - Intronic
970962799 4:21892495-21892517 CATAATATACATACAGAAAATGG - Intronic
971709229 4:30090186-30090208 CAGAATAAACAGACAACCTATGG + Intergenic
971745295 4:30572196-30572218 GAGAATATACAAACAGACACTGG + Intergenic
971754474 4:30689584-30689606 TAGAATAAGCAAATAGACAGAGG - Intergenic
971835273 4:31755272-31755294 CAGTTTAAACACACAGAAAAAGG + Intergenic
971837474 4:31786900-31786922 AAAAACAAACAAACAGAAAAAGG - Intergenic
972652262 4:41029766-41029788 CAGATTACACAAACTCACAATGG + Intronic
973020218 4:45195626-45195648 CAGGATTAACACATAGACAAAGG - Intergenic
973385080 4:49505914-49505936 CAGATTAACCAAACAAAGAAAGG - Intergenic
973692341 4:53450091-53450113 CAGAATAATCCAACAAAAAAAGG - Intronic
973771924 4:54214520-54214542 AAGAAAAAAAAAAAAGACAAAGG + Intronic
973814804 4:54609892-54609914 TAGAATAAACAAAAAAACTAAGG - Intergenic
973987583 4:56369951-56369973 AAAAAAAAAAAAACAGACAATGG + Intronic
974162880 4:58162831-58162853 CAGAAAGAGCAAACAAACAAAGG - Intergenic
974313625 4:60247350-60247372 CAGAATATACATATAGACCAGGG + Intergenic
974510989 4:62840141-62840163 TAAAATAAGCAAACAGATAAAGG + Intergenic
974617670 4:64310477-64310499 CAACACAAACAAACACACAAAGG - Intronic
975396436 4:73879455-73879477 CAGAGTAAACAGACAGCCTATGG - Intergenic
975658059 4:76661227-76661249 CAGAAAAAAAAAAAAGAAAATGG - Intronic
976221068 4:82757234-82757256 CAGAAGAACCACACAGACAAAGG - Intronic
976348360 4:84031085-84031107 CAAACTAAACAAAGAGACAAGGG + Intergenic
976818130 4:89174280-89174302 CAGAAAAAAAAAAAAGCCAAAGG + Intergenic
977113339 4:92988785-92988807 TGGAATAAACAAACTGACAAAGG + Intronic
977137009 4:93317451-93317473 TTTAAAAAACAAACAGACAAGGG + Intronic
977903556 4:102450392-102450414 CAGAATAAACAGACAACCTACGG + Intergenic
978038100 4:104021791-104021813 TTGAATATATAAACAGACAATGG + Intergenic
978518175 4:109591693-109591715 AAAAACAAACAAACAAACAATGG - Intronic
978922884 4:114206131-114206153 GAAAACAAACAAACAAACAATGG - Intergenic
978936920 4:114388895-114388917 CAGAATCAACAAGAAGACAAGGG + Intergenic
979098394 4:116581373-116581395 AAGAATAAAGAAAGAGAAAAAGG - Intergenic
979125006 4:116958578-116958600 CAGTATAAACAAACCCATAATGG + Intergenic
979207731 4:118060839-118060861 CAGAATAACCCAACCGCCAAAGG - Intronic
979257031 4:118616886-118616908 AAGAAAAAAAAAACAGATAATGG - Intergenic
979890414 4:126085247-126085269 CAGCCTAAACATACACACAAAGG - Intergenic
979896664 4:126166257-126166279 CACAATAAACTAACAGACAAAGG + Intergenic
980465833 4:133179488-133179510 CAGAATGTATAAACACACAAGGG - Intronic
980480548 4:133381471-133381493 CAGAATAAAAAGTCAGAGAAGGG + Intergenic
980946517 4:139325923-139325945 TAGCATATAAAAACAGACAACGG - Intronic
980998129 4:139801346-139801368 GAAAACAAACAAACAGAAAAAGG - Intronic
981040813 4:140219733-140219755 CAAAACAAACAAACAAACACAGG + Intergenic
981096975 4:140792003-140792025 AAGAATAACCAAACAGAAATGGG - Intergenic
981248894 4:142574785-142574807 CTGTATAAACAAACAAACAAAGG - Intronic
981642670 4:146963205-146963227 CAGGTGAAACAAACAGAGAAAGG + Intergenic
981962481 4:150557896-150557918 CAAAACAAACAAAAAAACAAAGG - Intronic
982348471 4:154387841-154387863 CAGTAAAAACAAATAGCCAAAGG + Intronic
982381137 4:154749146-154749168 CAGAATACACACACTGACATGGG - Exonic
982434173 4:155363411-155363433 CAAAATAAAAAAACAGAGAATGG + Intronic
982494728 4:156076758-156076780 AAGAATAGACAAATAGATAAAGG - Intergenic
982669058 4:158298540-158298562 AAAAAAAAACAAACAGAAAAGGG + Intergenic
982669986 4:158308832-158308854 CAGAATAAACAAAATAACATGGG - Intergenic
982842107 4:160202267-160202289 TAGCATAAAAAAAGAGACAAAGG - Intergenic
983354199 4:166634573-166634595 CAGAAAAAAAAAAAAAACAAGGG - Intergenic
983937389 4:173511419-173511441 CAAAACAAACAAACAAAAAACGG - Intergenic
984392726 4:179157498-179157520 AAGAATAAATAAACACAGAAGGG - Intergenic
984771824 4:183443511-183443533 CAGAATAAGCAAGCAAAAAAAGG - Intergenic
984793633 4:183637109-183637131 CAGCAATAACAAACAGAAAACGG + Intergenic
984798499 4:183689494-183689516 CCAAATAATCACACAGACAACGG - Intronic
1202768938 4_GL000008v2_random:181248-181270 CAGATTAACCAAACAAAGAAAGG - Intergenic
985600359 5:825667-825689 CAGAAAAAACAAAAAGTCACAGG + Intronic
986058238 5:4161135-4161157 GACAATATACAAACAAACAATGG + Intergenic
986481826 5:8197251-8197273 AAGAAGAAAACAACAGACAATGG + Intergenic
986503297 5:8424445-8424467 CAGAAAAAACAAACGAAAAAAGG - Intergenic
986570934 5:9165393-9165415 CAGAATTAATAAAAAGAGAATGG - Intronic
986662328 5:10070462-10070484 TAGAATAATCTAACAGAAAATGG - Intergenic
987064444 5:14274702-14274724 AAAAACAAACAAACAAACAATGG - Intronic
987492472 5:18598289-18598311 CAAAATAATTAAACAGAAAATGG + Intergenic
987607497 5:20156542-20156564 CAGAATGAAATAATAGACAATGG + Intronic
987689061 5:21243958-21243980 TAGATTGAACAAACAGATAATGG + Intergenic
987691667 5:21274847-21274869 CTGAATACACTAACAGACAATGG - Intergenic
987921970 5:24295156-24295178 ACAAATAAACAAACAAACAAGGG - Intergenic
987985377 5:25139452-25139474 CACAATAAACGAACAAAAAATGG + Intergenic
988149755 5:27362684-27362706 CACAATAAACAGAGAGAAAAGGG + Intergenic
988420899 5:31005155-31005177 CAAAGTAAACAAAGAAACAATGG - Intergenic
988507169 5:31833659-31833681 AAGAAAAAAGAAACAAACAAAGG + Intronic
988642134 5:33051194-33051216 CATAAGAAACAAACAAACAAAGG + Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
988952145 5:36274059-36274081 CAGAAAAAGGAAACAGAAAAAGG - Intronic
989173311 5:38494688-38494710 CAGTAAAAACAAACATAGAAAGG + Intronic
989191599 5:38675461-38675483 AAGAATAAAAAAACGGGCAAAGG + Intergenic
989320113 5:40124130-40124152 CAGAACAGACATACAGACAAAGG + Intergenic
989401138 5:41008885-41008907 CAGTAAAAACACACAGAAAAGGG + Intronic
990178162 5:53130200-53130222 ATGAATAAATAAACAAACAAAGG + Intergenic
990288175 5:54321611-54321633 CAGAACATACACACACACAAAGG - Intergenic
990425175 5:55680904-55680926 CAGAATAACAGAACAGATAAAGG + Intronic
990666100 5:58073628-58073650 CAGAATTAAAAAACATAAAAAGG - Intergenic
990686569 5:58309560-58309582 CCAAATAAACAAACAGAAAAAGG - Intergenic
990705486 5:58524293-58524315 AAAAACAAACAAACAGACCAAGG - Intergenic
990978106 5:61576669-61576691 CAGAAGAAACAAGCAGAGACTGG + Intergenic
991325801 5:65430651-65430673 CAAAATGAACAGACAGGCAAGGG + Intronic
991691910 5:69233677-69233699 AAAAACAAACAAACAAACAAAGG + Intergenic
991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG + Intergenic
991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG + Intergenic
991828312 5:70654939-70654961 CTGAATACACTAACAGACAATGG - Intergenic
991892646 5:71354542-71354564 CTGAATACACTAACAGACAATGG + Intergenic
992339869 5:75812364-75812386 GAGAATCAACAAAGAAACAATGG - Intergenic
992615894 5:78545821-78545843 CAGAATAAAGAATAAGACACTGG + Intronic
993687365 5:90955413-90955435 TTGAATAAACAAACATATAAAGG - Intronic
993695970 5:91062184-91062206 CAGAATAAATGAACAGAGAAAGG - Intronic
993991445 5:94662811-94662833 AAGAATAAACAAGGAAACAAGGG - Intronic
994052575 5:95379570-95379592 CATAATAAATAAACAGCCACAGG + Intergenic
994126462 5:96172634-96172656 CAGAATAAATTAAAAGACAGAGG + Intergenic
994151277 5:96450405-96450427 CAGAATGAAATAACAGACACTGG + Intergenic
994152941 5:96470392-96470414 CACAATAAATAAACAGATAATGG + Intergenic
994278329 5:97867172-97867194 AAGAAAAAAAAAACAGAAAAAGG - Intergenic
994445572 5:99869135-99869157 GACAAAAAACAAACAAACAATGG - Intergenic
995383230 5:111560100-111560122 CACTATAAACAAACTTACAAAGG - Intergenic
995421446 5:111971941-111971963 CAGAATAAAGAGACAGCCTATGG + Intronic
995802787 5:116017528-116017550 CACAATAAATAAAAGGACAAAGG - Intronic
996232213 5:121080110-121080132 TAAAATAATCAAAGAGACAATGG + Intergenic
996490907 5:124094949-124094971 CAGAATAAACAGACAACCCACGG - Intergenic
997401487 5:133606642-133606664 CAGAGTAAACACACAGAGCAAGG + Intronic
997843142 5:137260626-137260648 TAAAATAAGCAAACAGGCAAAGG + Intronic
997866113 5:137464308-137464330 ATAAATAAACAAACAAACAAAGG + Intronic
998149520 5:139748848-139748870 GAGAATAAATAAAGAGAGAAGGG + Intergenic
998316542 5:141188263-141188285 CAAAATAAATATACAGGCAATGG + Exonic
998317171 5:141193497-141193519 CAAAATAAATATACAGGCAATGG + Exonic
998718585 5:144915291-144915313 GAGAAAAATCAAACAGACAAGGG + Intergenic
998990997 5:147816684-147816706 TAGAAAAAACAAAAAGAAAAAGG - Intergenic
999190454 5:149743135-149743157 AAGAATAAACACATAAACAAAGG - Intronic
1000352923 5:160366455-160366477 GAGAATAAACAAGCAGACCTGGG + Intronic
1000739129 5:164944132-164944154 CATAATAAGCAAACAGCCAATGG - Intergenic
1001167893 5:169387699-169387721 CTGAAGAAAAAAACAGGCAAAGG - Intergenic
1002331659 5:178446333-178446355 CAAAAGAAATAAACAGAAAAAGG + Intronic
1002727886 5:181312724-181312746 AAGAAAAAAAAAACAGATAATGG - Intergenic
1003322404 6:5063517-5063539 CAGAATAAACAACCACACAAGGG - Intergenic
1003525835 6:6896283-6896305 CAGAAGGAAACAACAGACAATGG + Intergenic
1003849078 6:10203353-10203375 CAGAACAAAGAGACAAACAAAGG + Intronic
1004101063 6:12611960-12611982 CAGAAAAGACAGACAGACACAGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004883836 6:20033356-20033378 CAGAAGAAACAAACTGCGAACGG + Intergenic
1005142786 6:22652851-22652873 CAGAATGAAGAAAGAGGCAATGG + Intergenic
1005794681 6:29347480-29347502 GAGGATAAAGAAACAGAAAAGGG - Intergenic
1006214245 6:32426125-32426147 CTGGATATAGAAACAGACAATGG + Intergenic
1006244026 6:32714177-32714199 CAGAGAAAACAAAAAGATAATGG - Intergenic
1006270716 6:32964842-32964864 CAAAACAAACAAACAAACAAAGG + Intronic
1006821147 6:36896445-36896467 CCAAATAAAAAAATAGACAAAGG - Intronic
1007158438 6:39769261-39769283 AATTATAAACAAGCAGACAATGG + Intergenic
1007519371 6:42439617-42439639 CAAAACAAACAAACAAACAAAGG + Intronic
1007670981 6:43553571-43553593 CAGAAGACACAGAGAGACAATGG + Intronic
1007804827 6:44434565-44434587 CAAAATAAACAGGCAGTCAATGG - Intronic
1008100023 6:47380237-47380259 AAGAAGAAACAAACAGAAATGGG - Intergenic
1008112926 6:47512341-47512363 CAAAAAAAACAAACATAAAAAGG + Intronic
1008128566 6:47695194-47695216 CACAGCAAACAAAAAGACAAAGG + Intronic
1008227459 6:48937762-48937784 CAGAATAATTAACCAGAAAAAGG - Intergenic
1008281110 6:49597349-49597371 GTGAATAAACAAAAAGAAAAAGG + Intergenic
1008502690 6:52199436-52199458 AAAAATAAACAAACAGAAAAGGG + Intergenic
1008594775 6:53030582-53030604 CAAACTAAAAAAAGAGACAAAGG - Intronic
1009360084 6:62800728-62800750 GAAAATCAACAAACAAACAATGG - Intergenic
1009964148 6:70560201-70560223 AATAATAAACAATCAGACACAGG - Exonic
1010025514 6:71211752-71211774 CAGAATAAAAAAATAGAAGAAGG + Intergenic
1010336869 6:74695662-74695684 CTGAACAAACAACCAGACACAGG + Intergenic
1010416557 6:75618090-75618112 GAGGAAAAACAAACTGACAATGG - Intronic
1010705784 6:79108389-79108411 CAGACATAAGAAACAGACAAAGG - Intergenic
1010991941 6:82489545-82489567 CAGAAGAAACAAAAAGAGATGGG + Intergenic
1011319561 6:86075762-86075784 CAGAGTAAACAAACAACCCACGG - Intergenic
1011408353 6:87039693-87039715 CAGCAGAAACTAACAGATAACGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011499388 6:87971092-87971114 GAGAAAAAACAAACCGATAAGGG + Intergenic
1011749917 6:90445013-90445035 CAGAATAGAAAGAGAGACAAAGG + Intergenic
1012018873 6:93890390-93890412 CAGAATAATAAAAGAGATAAAGG - Intergenic
1012195707 6:96338905-96338927 CAGAAGAAAAAAACAGCAAATGG - Intergenic
1012265965 6:97143576-97143598 CAGAAAAAACAAACAACCAGTGG + Exonic
1012428407 6:99140191-99140213 AAGAATTAAGAAACAAACAAGGG - Intergenic
1012432944 6:99185424-99185446 CAGAGTCAACAAATAAACAAGGG - Intergenic
1012746480 6:103096499-103096521 CAGAATAAACAGAAATACAGGGG - Intergenic
1012960982 6:105621498-105621520 CAGGTTAAAGAAACAAACAAGGG + Intergenic
1013245252 6:108280513-108280535 AAGAATAAACAAGGAGACAAGGG - Intergenic
1013399586 6:109779564-109779586 AAAAACAAACAAACAGAAAAAGG - Intronic
1013564999 6:111349571-111349593 CATAAAAAACAAACAAAAAAAGG - Intronic
1013718317 6:112990661-112990683 CAGAGAAAACAAACGGAAAATGG - Intergenic
1013857144 6:114586913-114586935 CAAAATAAACAGAAAAACAATGG + Intergenic
1013938267 6:115626989-115627011 TAGAATAAACCTACAGAAAATGG - Intergenic
1014482695 6:121957273-121957295 CAGAATAATCATTCAGAGAAAGG + Intergenic
1014687841 6:124525875-124525897 TAAAATAAGCAAACAGAAAATGG + Intronic
1014792046 6:125683464-125683486 CAAAAAAAAAAAAAAGACAAAGG - Intergenic
1014830514 6:126097901-126097923 AAGAATAAACAAAAAGAGTATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015008635 6:128315007-128315029 AAAAACAAACAAACAAACAAAGG + Intronic
1015061612 6:128973755-128973777 CAGAAGAATCACAGAGACAAGGG + Intronic
1015230309 6:130907658-130907680 CAGAATAAAAAAAGAGAGTAGGG + Intronic
1015472780 6:133624806-133624828 CAAATTAACCAAACAGACAAGGG - Intergenic
1015734778 6:136387176-136387198 CAGAATAAGCAAACAAAAAGAGG + Intronic
1016061281 6:139633745-139633767 TTGCATAAACAAACAGGCAAAGG + Intergenic
1016208111 6:141495212-141495234 CCATATAAACAAACATACAATGG - Intergenic
1016445213 6:144125014-144125036 AAGAAGGAACAAACAGACATTGG - Intergenic
1016849331 6:148601104-148601126 CAGACTGAATATACAGACAATGG + Intergenic
1017452563 6:154567336-154567358 CTGAATCAACAAACAAACAAGGG + Intergenic
1017963492 6:159243567-159243589 GAGAATAAACAAAACGACTATGG + Intronic
1018262102 6:161980507-161980529 CAGAAGAACTAAACAGAGAAAGG + Intronic
1018412923 6:163572802-163572824 CATAGTAAATAAACTGACAACGG - Exonic
1018767217 6:166944146-166944168 TAAAACAAACAAACAAACAAAGG + Intronic
1019810394 7:3161062-3161084 CAGCAACAACAAACACACAAGGG - Intronic
1020076238 7:5260809-5260831 CAAAACAAACAAACAAAAAAAGG - Intergenic
1020761508 7:12272664-12272686 CAGAATAAATAAACAGCACATGG - Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1021252766 7:18352184-18352206 CAGATTAAACAGACAGCCTAAGG - Intronic
1021350172 7:19583093-19583115 CAGAACAAACAAAAACAAAATGG + Intergenic
1021792659 7:24221590-24221612 AAGGATATACAAATAGACAATGG + Intergenic
1021878343 7:25069758-25069780 AACAAAAAACAAACAGAAAATGG + Intergenic
1022592101 7:31673387-31673409 CTGAAAATAGAAACAGACAATGG - Intergenic
1022758646 7:33323272-33323294 CAAAATAAACAAAGAAACATCGG - Intronic
1022881310 7:34590736-34590758 CAAAATTAATAGACAGACAATGG - Intergenic
1023130663 7:36999576-36999598 CAGAATAAAGAAAGAGAAATAGG + Intronic
1023332117 7:39129537-39129559 CACAATTAACAAACAGGCATTGG - Intronic
1023586052 7:41730876-41730898 AAGAATAAACAATGAGACAGCGG + Intergenic
1023631361 7:42167260-42167282 GAAAATAAACAAACAGATTAAGG + Intronic
1023687510 7:42751769-42751791 CAGAATGGAAAAACAGACAGTGG + Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024133490 7:46382336-46382358 CATAATAGACAAATAGACAATGG + Intergenic
1024152654 7:46588587-46588609 AAAAATAAACAAACAAAAAAAGG + Intergenic
1024449421 7:49522087-49522109 TAGAATCAAGAATCAGACAAAGG - Intergenic
1024740293 7:52346524-52346546 TGTGATAAACAAACAGACAAGGG - Intergenic
1025202847 7:56972762-56972784 CAAAACAAACAAACAAAAAAAGG + Intergenic
1025669097 7:63604164-63604186 CAAAACAAACAAACAAAAAAAGG - Intergenic
1025964062 7:66251713-66251735 CAAACTAAACAAAGAAACAAAGG - Intronic
1025993748 7:66514952-66514974 CAGAAGTAACAAACACAAAATGG - Intergenic
1026034671 7:66822482-66822504 CAGAAGTAACAAACACAAAATGG + Intergenic
1026577464 7:71584131-71584153 CAAAACAAACAAACAAAAAAGGG + Intronic
1026632906 7:72053227-72053249 CTCAAAAAACAAACAAACAAAGG + Intronic
1026681536 7:72470946-72470968 TAAAACAAACAAACAAACAAAGG - Intergenic
1026984958 7:74548946-74548968 CAGAAGTAACAAACACAAAATGG - Intronic
1027544912 7:79515491-79515513 GAGAATAAACCAAGAGACCAAGG + Intergenic
1027611505 7:80367345-80367367 AAAAACAAACAAACAAACAAAGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028956581 7:96700312-96700334 CAGAGTACACAACCAGACAAAGG + Intronic
1029095952 7:98085319-98085341 CAAAACAAACAAACAGAAATGGG - Intergenic
1029295239 7:99535180-99535202 AACAAAAAACAAACAAACAATGG - Intergenic
1029855571 7:103513010-103513032 CACAGTAAAAAAACAGATAATGG - Intronic
1030160173 7:106499724-106499746 GAAAGTAAACAAAAAGACAAGGG + Intergenic
1030425390 7:109370423-109370445 TAGAATAAGCAGACAGCCAACGG - Intergenic
1030518418 7:110566076-110566098 GAGTATTAGCAAACAGACAAGGG - Intergenic
1030722803 7:112889500-112889522 GAGAATACACACACACACAATGG + Intronic
1030974552 7:116105448-116105470 CAGAAAAAAGAAACATACACAGG + Intronic
1031102513 7:117499793-117499815 AAAAACAAACAAACAAACAAAGG + Intronic
1031368988 7:120940685-120940707 CAGAAAAAACAAAAAGTCAAAGG - Intergenic
1031435838 7:121730646-121730668 CAGCAGAAACAATAAGACAAAGG - Intergenic
1031616738 7:123890225-123890247 CAGAAAAAACAAACAAATAAAGG + Intergenic
1031719473 7:125153310-125153332 CAGGATATAGAAACACACAAGGG - Intergenic
1031788118 7:126060448-126060470 CCGAATACACAAACATAAAAGGG - Intergenic
1032112625 7:129089665-129089687 ATGAAAATACAAACAGACAATGG + Intergenic
1032204468 7:129849984-129850006 CAAAATAAAAAAACAGAAACAGG + Intronic
1032331498 7:130985152-130985174 CAAAACAAACAAACAAACAAAGG - Intergenic
1032890970 7:136194030-136194052 CATAATAAACAAAATGAAAAGGG - Intergenic
1032956218 7:136974545-136974567 CAGAATACACAAAAACACAGAGG + Intronic
1033071904 7:138210549-138210571 CAGTATAAGAAAACAGAAAATGG + Intergenic
1033829091 7:145230769-145230791 CAGAATAAATAGACACAAAATGG - Intergenic
1034381935 7:150704582-150704604 TAAAATCAACAAAGAGACAATGG + Intergenic
1034594221 7:152174044-152174066 TAGAAAAAACATACAGAAAATGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034910321 7:154992147-154992169 AAAAACAAACAAACAAACAAGGG - Intronic
1035204604 7:157287080-157287102 CAAAACAAACATACAAACAAAGG - Intergenic
1035556242 8:569297-569319 CCGAATATGCAAACAGACAAGGG - Intergenic
1035848745 8:2893040-2893062 CAAAATAAAGAAAAAGACACTGG - Intergenic
1035915277 8:3613624-3613646 CAAAATATACAAACAAAAAATGG + Intronic
1036047620 8:5161353-5161375 CAGAATAATCACAAACACAAAGG + Intergenic
1037067252 8:14597464-14597486 CAAAACAAACAAACAAAAAAAGG - Intronic
1037268560 8:17098327-17098349 CAAAACAAACAAACAAAAAAAGG + Intronic
1037698984 8:21255215-21255237 CAGAATAAAGAAATAGAAAAAGG - Intergenic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1038419706 8:27425422-27425444 CAAAATAAACAAACAAAAGAAGG - Intronic
1038485708 8:27933741-27933763 CATGATAAATAAACAGAGAAAGG - Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038775246 8:30524250-30524272 GACAATAAACAAACATAAAAAGG - Intronic
1038795668 8:30707132-30707154 AAAAACAAACAAACACACAATGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1038890344 8:31714076-31714098 CATTATAAAGAAACAGAGAAAGG - Intronic
1038979537 8:32742648-32742670 GAGAAGAAACAAAAAAACAATGG - Intronic
1039321012 8:36431088-36431110 CATAAGAGACAAACAGTCAAAGG + Intergenic
1039919730 8:41884835-41884857 ATAAATAAACAAACAAACAAGGG + Intronic
1040138751 8:43885538-43885560 CAAAATATTAAAACAGACAATGG - Intergenic
1040374194 8:46807153-46807175 CAGAAGAAACAAAAAGAGATGGG - Intergenic
1040687860 8:49897331-49897353 CATATTGAACAGACAGACAATGG + Intergenic
1040811462 8:51458818-51458840 GATAAGAAAGAAACAGACAATGG + Intronic
1041033502 8:53762616-53762638 AAGAATAAACAAATAGATGATGG + Intronic
1041416206 8:57611218-57611240 GAAAAGAAACAAACATACAAAGG + Intergenic
1041507920 8:58621911-58621933 CAGAGTAAACAGACAGCCCACGG - Intronic
1041793848 8:61725646-61725668 CAGAATAAACAGACTGAGATAGG - Intergenic
1041873113 8:62657942-62657964 CCAAATAACCAAAAAGACAAAGG + Intronic
1042213842 8:66408960-66408982 CAAAATAAATAAAGAGATAAAGG + Intergenic
1042469652 8:69170280-69170302 TAGAATAAAAAGCCAGACAAGGG - Intergenic
1042510431 8:69605414-69605436 AACAATAAACAAACAGAATATGG - Intronic
1042884271 8:73530735-73530757 CTGAAAAAACAAAAAGATAAAGG + Intronic
1043231393 8:77805788-77805810 AAGAATAGACAAATAGGCAATGG + Intergenic
1043469930 8:80552022-80552044 GAAAACAAACAAACAAACAAGGG - Intergenic
1043759909 8:84055258-84055280 CAGATCAAACAAAAAGGCAAAGG + Intergenic
1044006550 8:86943803-86943825 CACAATAAACAAAAAGGGAAGGG + Intronic
1044034115 8:87276435-87276457 CAGAACAAGCAACCAGACCATGG - Intronic
1044377356 8:91491962-91491984 CAGAATTAACAAAAACACACAGG - Intergenic
1044798051 8:95924079-95924101 CAGAATAAAAAATCAGACAAGGG + Intergenic
1045170328 8:99659115-99659137 AAGACTAAAAAAACTGACAACGG - Intronic
1045463250 8:102445012-102445034 CAGAACAAATAAACAGAGGAAGG + Intergenic
1045530864 8:102984172-102984194 CAGAATGAATTAACAGAAAAGGG - Intergenic
1045868733 8:106900880-106900902 CAGAGTAAACAGACAGCCTAAGG - Intergenic
1046052016 8:109034939-109034961 AAGAAGAAACAAACAAATAATGG + Intergenic
1046079225 8:109350776-109350798 CCAATTAAAAAAACAGACAAAGG - Intergenic
1046336339 8:112793582-112793604 CAAAACAAACAAACAAAAAAAGG + Intronic
1046604574 8:116356720-116356742 CAGAAAAAGGAAACAGAAAATGG - Intergenic
1046685270 8:117219033-117219055 CAAAATAAAAAAACAAAAAAAGG + Intergenic
1046996051 8:120524572-120524594 CACTATAAACAAAAAGACAAAGG - Intronic
1047525481 8:125630218-125630240 CAAAATCAAAAAACAGAAAATGG + Intergenic
1047937146 8:129793457-129793479 CAAAACAAAAAAACATACAATGG - Intergenic
1047971032 8:130084787-130084809 AAGAAAAAACAAAAAAACAAAGG + Intronic
1048077205 8:131084516-131084538 CAAAACAAACATACAAACAAAGG + Intergenic
1049078553 8:140421452-140421474 CAGAAAACAAAAACATACAAAGG - Intronic
1049318843 8:141984976-141984998 CACAAGAAATCAACAGACAATGG - Intergenic
1049728781 8:144164980-144165002 AAAAACAAACAAACAAACAAAGG - Intronic
1050232884 9:3547372-3547394 CAGGATACACACTCAGACAAGGG + Intergenic
1050285433 9:4097018-4097040 ATAAATAAACAAACAAACAAAGG + Intronic
1050320151 9:4444196-4444218 CAGCATAAAAAGACATACAAAGG + Intergenic
1050824292 9:9925825-9925847 CAAAACAAACAAACAAACAAAGG - Intronic
1050840800 9:10146723-10146745 CAAAACAAACAAACAAAAAAAGG - Intronic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051501517 9:17783032-17783054 CAGAACACACACACAGACAGGGG + Intronic
1051585926 9:18726826-18726848 CAGAATAGATAAACAGGGAAGGG + Intronic
1051796164 9:20872864-20872886 CAGAATAAGCAAACTTACAGAGG - Intronic
1052040119 9:23728768-23728790 TAGAAAGAACAAACAGGCAAAGG + Intronic
1052169168 9:25372512-25372534 CTCAAAAAACAAACAAACAAAGG + Intergenic
1052495136 9:29214558-29214580 CACAAAAAACAAAAAAACAACGG - Intergenic
1053206330 9:36189557-36189579 GAGCATAAAACAACAGACAAGGG + Intergenic
1053493613 9:38531830-38531852 TAAAATAAACAAACAGAAAATGG + Intergenic
1055662164 9:78515441-78515463 GAGAATAAACCAACAGGGAATGG - Intergenic
1055850174 9:80617965-80617987 AAGAAAAAACAAATAGTCAATGG - Intergenic
1055869422 9:80856036-80856058 CAGAGTAAACAAACAACCTATGG - Intergenic
1055920782 9:81458684-81458706 CAAAATAAACAAACCCACAGAGG - Intergenic
1056044164 9:82699687-82699709 GAAAAAAAACAAAGAGACAAAGG - Intergenic
1056099868 9:83291026-83291048 AAGAAGAAACAAAAAGACATGGG + Intronic
1056172665 9:84002455-84002477 TAGAACAGACAAATAGACAAAGG - Exonic
1056205893 9:84318869-84318891 CAGAAAAAAAAAAAAGAAAAAGG + Intronic
1056520077 9:87393027-87393049 CTGAATACACAAACAGATGATGG + Intergenic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1056668888 9:88606293-88606315 CAGAATAAAGAAAAATACACAGG - Intergenic
1057658606 9:96979263-96979285 CAAAAAAAAAAAACAGAAAAAGG + Intronic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1057674352 9:97126652-97126674 CAAAACAAACAAACAGAAAATGG + Intergenic
1057698264 9:97342744-97342766 GAGAAGAAATAAACAGACCAAGG - Intronic
1058054770 9:100438239-100438261 CAGAATAAAAAAACAAAATAGGG + Intronic
1058306338 9:103445900-103445922 CAGACTAAAAAAATAGAGAATGG - Intergenic
1058838403 9:108880458-108880480 CAAAACAAACAAACAAAAAAAGG + Intronic
1059110145 9:111549895-111549917 CAAAATAAACCAACAAAAAATGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059580610 9:115544090-115544112 CAGCATAAACATACAGAACATGG + Intergenic
1059584678 9:115593306-115593328 AAAAACAAACAAACAAACAAAGG - Intergenic
1060165133 9:121406894-121406916 CAGAGGAAACAAAAAAACAAAGG + Intergenic
1060359063 9:122937602-122937624 AAAAACAAACAAACAGAAAAAGG + Intergenic
1060624658 9:125100703-125100725 GAGAAAAAGCAAGCAGACAAAGG + Intronic
1061044647 9:128158498-128158520 CAAAACAAACAAACAAACAAAGG + Intergenic
1061470853 9:130824348-130824370 TAGAACAAAAAAACAGAAAAAGG - Intronic
1061702354 9:132425319-132425341 CAGAATAAATTATCTGACAAAGG - Intronic
1062588068 9:137259410-137259432 GGGAATAAACAAACAGGGAAGGG - Intronic
1062752951 9:138269868-138269890 AAGAAAAAAAAAACAGATAATGG - Intergenic
1203575467 Un_KI270745v1:4642-4664 AAGAAAAAAAAAACAGATAATGG - Intergenic
1185985393 X:4827057-4827079 AACAATAAACAAACAAACAAGGG - Intergenic
1186295399 X:8143165-8143187 CAGACTAAATGAGCAGACAATGG + Intergenic
1186640906 X:11454387-11454409 CAGAGTAAAGAAAAAGAGAAAGG + Intronic
1186678356 X:11844802-11844824 CAGAATCATCAAAGAGAGAAAGG - Intergenic
1186938731 X:14480305-14480327 CAGAGTAAACAAACAACCTACGG - Intergenic
1187065761 X:15836303-15836325 AAGAAGAAACAAACAAAAAAGGG + Intronic
1187914762 X:24142980-24143002 AACAATAGAAAAACAGACAAAGG + Intergenic
1187946652 X:24432694-24432716 AAGCGTAAACAAAAAGACAATGG + Intergenic
1188087475 X:25918379-25918401 CAGAAAAAAAAAACAGATCAAGG - Intergenic
1188116077 X:26244147-26244169 CAGAATAAACATGAAAACAAGGG - Intergenic
1188284438 X:28311042-28311064 TAGAATGAGCAAACAAACAATGG - Intergenic
1189393560 X:40599564-40599586 GAGAACAAACAAACAAAAAAAGG - Intronic
1189623643 X:42871283-42871305 CAGAAAATAAAAACAAACAAAGG - Intergenic
1189637420 X:43025981-43026003 CAGCATAAACTTAGAGACAAAGG - Intergenic
1189670625 X:43404647-43404669 CAGGATAAGGAAACAGACTAGGG + Intergenic
1189786239 X:44560984-44561006 ATAAATAAACAAACAAACAAAGG + Intergenic
1189870300 X:45374583-45374605 CAAAATGAACAAAGAAACAATGG + Intergenic
1189938069 X:46090370-46090392 CAGAATAATGAAAAAGAAAAGGG + Intergenic
1190079986 X:47348886-47348908 AAAAAGAAACAAACAAACAAAGG - Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190901570 X:54679293-54679315 AAGATTAAAAAAAAAGACAAAGG + Intergenic
1191153017 X:57241343-57241365 CAGAGTAAACAAACAGCCTATGG + Intergenic
1191647599 X:63499079-63499101 CAGAAAAAAGAAAGAGATAAAGG + Intergenic
1191744571 X:64472253-64472275 CAGAATAAACAAATCTATAACGG - Intergenic
1191767599 X:64715337-64715359 CAGAAACAACAAAATGACAAGGG + Intergenic
1191845091 X:65541141-65541163 CAAAACAAACAAAAAAACAAAGG - Intergenic
1193139645 X:78014022-78014044 CCCAATAAACACACAGGCAAAGG - Intronic
1193307715 X:79969293-79969315 CATAACAAACAAACAAACAAAGG - Intergenic
1193327334 X:80194650-80194672 GAGAATTATCAAAAAGACAAAGG - Intergenic
1193747639 X:85301201-85301223 CATAATAATCAAACAGTCAAGGG + Intronic
1193884503 X:86968522-86968544 CAAAGTCAACAAAAAGACAATGG + Intergenic
1194132123 X:90094352-90094374 CAGAATCAATGAAGAGACAAAGG + Intergenic
1194149069 X:90300913-90300935 CATAACAAACACACAGACAGAGG + Intergenic
1194153494 X:90356733-90356755 ATGAATACACACACAGACAAGGG + Intergenic
1194378130 X:93161296-93161318 CAGAACATACAAACAGTCTAAGG + Intergenic
1194854949 X:98916735-98916757 AAGAATAGACATATAGACAAAGG - Intergenic
1194981369 X:100444502-100444524 CATAACAGACAAAAAGACAAAGG - Intergenic
1195647466 X:107249122-107249144 CAGAAGAAAAATACAGAAAATGG - Intergenic
1195775814 X:108404991-108405013 CACACAAAACAAACATACAATGG + Intronic
1195800027 X:108698334-108698356 CAAAACAAACAAACAAACAAAGG - Intergenic
1195851898 X:109292903-109292925 TAGAAAAAAAAAACATACAATGG - Intergenic
1195949400 X:110251641-110251663 CAGAATAAGAACCCAGACAAAGG + Intronic
1196260529 X:113574913-113574935 TAAAACAAACACACAGACAAAGG - Intergenic
1196981258 X:121216079-121216101 AAGGATAGACAAATAGACAAAGG - Intergenic
1197274693 X:124464698-124464720 CAGCATACACACACAGACACAGG + Intronic
1197622835 X:128770378-128770400 CAGAATAAAAAAATAGAGAGAGG + Intergenic
1197700016 X:129592398-129592420 CAGAATAAGAAAACAGTGAAAGG - Exonic
1198377939 X:136058047-136058069 AAGATTACAAAAACAGACAAAGG - Intergenic
1198805466 X:140490018-140490040 CTGAATAAACATACAGAAAATGG + Intergenic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1199212516 X:145230205-145230227 ATGTATAAAAAAACAGACAAAGG + Intergenic
1199223998 X:145350939-145350961 TAGAATAAATAAACATAAAATGG + Intergenic
1199830189 X:151541822-151541844 TAAAAAAAAAAAACAGACAATGG - Intergenic
1200495442 Y:3877645-3877667 CATAACAAACAGACAGACAGAGG + Intergenic
1200499830 Y:3933529-3933551 ATGAATACACACACAGACAACGG + Intergenic
1200614326 Y:5360832-5360854 CAGAAGGAACAAAAATACAAAGG + Intronic
1200781479 Y:7220248-7220270 CTGAAAATATAAACAGACAATGG + Intergenic
1201618408 Y:15927403-15927425 CAGAAAAAACAAGAAGAAAAAGG - Intergenic