ID: 924051304

View in Genome Browser
Species Human (GRCh38)
Location 1:240082066-240082088
Sequence GCCCGAGAACCCACTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924051304_924051308 -9 Left 924051304 1:240082066-240082088 CCCCCAAAAGTGGGTTCTCGGGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 924051308 1:240082080-240082102 TTCTCGGGCAAGAAAGAATTTGG 0: 1
1: 1
2: 26
3: 103
4: 324
924051304_924051309 4 Left 924051304 1:240082066-240082088 CCCCCAAAAGTGGGTTCTCGGGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 924051309 1:240082093-240082115 AAGAATTTGGTGCTAGTCCATGG 0: 1
1: 0
2: 4
3: 22
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924051304 Original CRISPR GCCCGAGAACCCACTTTTGG GGG (reversed) Intronic
901166657 1:7226153-7226175 TCCAAAGAACCCACTTTTAGGGG + Intronic
901325417 1:8362477-8362499 GCTCGAGCACCAACTCTTGGGGG - Intronic
913331067 1:117668266-117668288 GCCAGAGAACGCACTTCTTGAGG - Intergenic
924051304 1:240082066-240082088 GCCCGAGAACCCACTTTTGGGGG - Intronic
1064378156 10:14815665-14815687 GCCTGAGAACCCTCTTTTCATGG - Intergenic
1071687050 10:87769687-87769709 GCCTGTAATCCCACTTTTGGAGG + Intronic
1097425730 12:59441716-59441738 GACCAAAAACCCACTGTTGGTGG - Intergenic
1103680373 12:122689171-122689193 GCTCCAGAACACACATTTGGAGG + Intergenic
1106002960 13:25741793-25741815 GCCCCAGAACCCAATTTTCTGGG - Intronic
1110864479 13:80378952-80378974 GCATGAGAACCCTCTCTTGGAGG - Intergenic
1118398931 14:65361860-65361882 CCCCAAGAATCCACTTTTAGTGG + Intergenic
1127669617 15:61182879-61182901 GCCAGAGAACCCAAATTGGGGGG + Intronic
1133180419 16:4050050-4050072 TCCCGAGAGTCCACTGTTGGGGG + Intronic
1141589083 16:85055875-85055897 GCCCGAGAGCCCACGCTTGTTGG - Intronic
1141841125 16:86574786-86574808 CCCAGAGCACCCACTTTTGGAGG + Intergenic
1144677786 17:17172909-17172931 GCCCCAGGCCCCACTTCTGGAGG - Intronic
1157693917 18:49705544-49705566 GCCTGTGATCCCACTTTGGGAGG - Intergenic
1160310208 18:77782449-77782471 GCCCGTAATCCCACTTTGGGAGG - Intergenic
1163250646 19:16124630-16124652 GCCCCAGAACCCACATGTGGGGG - Intronic
1163779516 19:19239264-19239286 GCCAGAGTCCCCACTTGTGGAGG + Intronic
1166855707 19:45781817-45781839 GCCATAGAGCCCACTTTTGGGGG + Intronic
1168527251 19:57099135-57099157 GCCCGTAAACCCAAATTTGGGGG + Intergenic
925052593 2:828824-828846 GTCCAAGACCCCAATTTTGGGGG - Intergenic
925060539 2:886636-886658 GACAGAGAACCTACTTTTGATGG + Intergenic
927811584 2:26183375-26183397 GCCCCAGCACCCACTTGTAGAGG + Intronic
936040112 2:109143068-109143090 GCCCGGGAACCCAGTGTGGGGGG + Intronic
937271747 2:120657232-120657254 GCCTGAGAGCCCACCTTTGGGGG - Intergenic
942481169 2:176390017-176390039 GCCCAAGACCACACTGTTGGTGG + Intergenic
943013305 2:182478774-182478796 GCCCCAGATCCCATATTTGGAGG + Intronic
948018951 2:234714601-234714623 GCTCTAGAACCCAGTATTGGGGG + Intergenic
1168893657 20:1309610-1309632 GCATGAGAAGCCACTTTAGGGGG - Intergenic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1182714901 22:32350099-32350121 GCCAGAGACCCCATTTTAGGAGG - Intergenic
1185037791 22:48489050-48489072 GTCCCAGAACCCACCTTAGGAGG + Intergenic
950074641 3:10178529-10178551 GCCAGAGAACACAGTATTGGAGG + Intronic
953274557 3:41482141-41482163 ATCCAAGAACCCTCTTTTGGGGG + Intronic
954213946 3:49113994-49114016 GCCTGAGAACCTGCGTTTGGCGG - Exonic
959828937 3:110836318-110836340 GCACGGGAACCCACTTGAGGAGG + Intergenic
960571459 3:119188964-119188986 GCAAAAGTACCCACTTTTGGTGG + Intronic
969696143 4:8735954-8735976 GCCAGATTTCCCACTTTTGGGGG + Intergenic
978869034 4:113552565-113552587 GCACGTGATCCCACTTTTGTGGG - Intronic
993956487 5:94240726-94240748 GCCAGAGATCCCATTTTTGACGG - Intronic
994793706 5:104265820-104265842 ACCCAAGAAGCCACATTTGGAGG + Intergenic
996846095 5:127900506-127900528 GCCATATAACCCACTTTTGAAGG + Intergenic
1001421890 5:171593877-171593899 GTCTGCGAACCCAGTTTTGGGGG - Intergenic
1002759769 6:192371-192393 GCCCCAGACCCCACATGTGGAGG + Intergenic
1003130692 6:3392987-3393009 GCCCCAGATCCAACCTTTGGAGG + Intronic
1014921145 6:127215072-127215094 GCCTGGGCTCCCACTTTTGGCGG - Intergenic
1019210900 6:170403884-170403906 GCCGGAGCCCACACTTTTGGGGG + Intronic
1050932654 9:11349496-11349518 GTCTGAGTACCCACGTTTGGTGG + Intergenic
1062169675 9:135128043-135128065 GCCAGAGAAGGCACTTTTCGTGG - Intergenic
1185737344 X:2503603-2503625 ATCCAAGAACCCACTCTTGGGGG + Intergenic
1192503545 X:71667915-71667937 GGCCGAGACCTCAATTTTGGGGG + Intergenic
1192707478 X:73541564-73541586 GCATGAGAACCCACTTGAGGAGG - Intergenic
1192772466 X:74207231-74207253 CCCCGAGGACTCAATTTTGGGGG + Intergenic