ID: 924052249

View in Genome Browser
Species Human (GRCh38)
Location 1:240091493-240091515
Sequence ACCCCCTGTCTGCCTCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924052249_924052256 23 Left 924052249 1:240091493-240091515 CCATGCAGAGGCAGACAGGGGGT 0: 1
1: 0
2: 1
3: 23
4: 273
Right 924052256 1:240091539-240091561 GGCACCTCTAAACTGGAATTGGG 0: 1
1: 0
2: 3
3: 19
4: 140
924052249_924052252 16 Left 924052249 1:240091493-240091515 CCATGCAGAGGCAGACAGGGGGT 0: 1
1: 0
2: 1
3: 23
4: 273
Right 924052252 1:240091532-240091554 ACCCGATGGCACCTCTAAACTGG 0: 1
1: 0
2: 0
3: 1
4: 47
924052249_924052255 22 Left 924052249 1:240091493-240091515 CCATGCAGAGGCAGACAGGGGGT 0: 1
1: 0
2: 1
3: 23
4: 273
Right 924052255 1:240091538-240091560 TGGCACCTCTAAACTGGAATTGG 0: 1
1: 0
2: 1
3: 3
4: 95
924052249_924052251 2 Left 924052249 1:240091493-240091515 CCATGCAGAGGCAGACAGGGGGT 0: 1
1: 0
2: 1
3: 23
4: 273
Right 924052251 1:240091518-240091540 TGTATGTGGCTGTGACCCGATGG 0: 1
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924052249 Original CRISPR ACCCCCTGTCTGCCTCTGCA TGG (reversed) Intronic