ID: 924052251

View in Genome Browser
Species Human (GRCh38)
Location 1:240091518-240091540
Sequence TGTATGTGGCTGTGACCCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924052249_924052251 2 Left 924052249 1:240091493-240091515 CCATGCAGAGGCAGACAGGGGGT 0: 1
1: 0
2: 1
3: 23
4: 273
Right 924052251 1:240091518-240091540 TGTATGTGGCTGTGACCCGATGG 0: 1
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924052251 Original CRISPR TGTATGTGGCTGTGACCCGA TGG Intronic