ID: 924052252 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:240091532-240091554 |
| Sequence | ACCCGATGGCACCTCTAAAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 49 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 47} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 924052249_924052252 | 16 | Left | 924052249 | 1:240091493-240091515 | CCATGCAGAGGCAGACAGGGGGT | 0: 1 1: 0 2: 1 3: 23 4: 273 |
||
| Right | 924052252 | 1:240091532-240091554 | ACCCGATGGCACCTCTAAACTGG | 0: 1 1: 0 2: 0 3: 1 4: 47 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 924052252 | Original CRISPR | ACCCGATGGCACCTCTAAAC TGG | Intronic | ||