ID: 924052255 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:240091538-240091560 |
Sequence | TGGCACCTCTAAACTGGAAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 100 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 3, 4: 95} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
924052249_924052255 | 22 | Left | 924052249 | 1:240091493-240091515 | CCATGCAGAGGCAGACAGGGGGT | 0: 1 1: 0 2: 1 3: 23 4: 273 |
||
Right | 924052255 | 1:240091538-240091560 | TGGCACCTCTAAACTGGAATTGG | 0: 1 1: 0 2: 1 3: 3 4: 95 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
924052255 | Original CRISPR | TGGCACCTCTAAACTGGAAT TGG | Intronic | ||