ID: 924052255

View in Genome Browser
Species Human (GRCh38)
Location 1:240091538-240091560
Sequence TGGCACCTCTAAACTGGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924052249_924052255 22 Left 924052249 1:240091493-240091515 CCATGCAGAGGCAGACAGGGGGT 0: 1
1: 0
2: 1
3: 23
4: 273
Right 924052255 1:240091538-240091560 TGGCACCTCTAAACTGGAATTGG 0: 1
1: 0
2: 1
3: 3
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924052255 Original CRISPR TGGCACCTCTAAACTGGAAT TGG Intronic