ID: 924052256 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:240091539-240091561 |
| Sequence | GGCACCTCTAAACTGGAATT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 163 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 19, 4: 140} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 924052249_924052256 | 23 | Left | 924052249 | 1:240091493-240091515 | CCATGCAGAGGCAGACAGGGGGT | 0: 1 1: 0 2: 1 3: 23 4: 273 |
||
| Right | 924052256 | 1:240091539-240091561 | GGCACCTCTAAACTGGAATTGGG | 0: 1 1: 0 2: 3 3: 19 4: 140 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 924052256 | Original CRISPR | GGCACCTCTAAACTGGAATT GGG | Intronic | ||