ID: 924052256

View in Genome Browser
Species Human (GRCh38)
Location 1:240091539-240091561
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924052249_924052256 23 Left 924052249 1:240091493-240091515 CCATGCAGAGGCAGACAGGGGGT 0: 1
1: 0
2: 1
3: 23
4: 273
Right 924052256 1:240091539-240091561 GGCACCTCTAAACTGGAATTGGG 0: 1
1: 0
2: 3
3: 19
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type