ID: 924052506

View in Genome Browser
Species Human (GRCh38)
Location 1:240092619-240092641
Sequence GGATGGACAAAGGACCAGCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924052498_924052506 15 Left 924052498 1:240092581-240092603 CCGATCGCCGAGGATGTGGAAAC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 924052506 1:240092619-240092641 GGATGGACAAAGGACCAGCTCGG 0: 1
1: 0
2: 1
3: 15
4: 174
924052496_924052506 19 Left 924052496 1:240092577-240092599 CCGGCCGATCGCCGAGGATGTGG 0: 1
1: 0
2: 0
3: 3
4: 24
Right 924052506 1:240092619-240092641 GGATGGACAAAGGACCAGCTCGG 0: 1
1: 0
2: 1
3: 15
4: 174
924052499_924052506 8 Left 924052499 1:240092588-240092610 CCGAGGATGTGGAAACTGCAGCA 0: 1
1: 1
2: 8
3: 150
4: 1804
Right 924052506 1:240092619-240092641 GGATGGACAAAGGACCAGCTCGG 0: 1
1: 0
2: 1
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924052506 Original CRISPR GGATGGACAAAGGACCAGCT CGG Exonic
902248823 1:15140057-15140079 GGACGGCCCAAGGGCCAGCTGGG + Intergenic
903058564 1:20653780-20653802 GGAGGGAAACAGGAGCAGCTTGG + Intronic
903847757 1:26288570-26288592 GGATGGAGAGAGGTGCAGCTGGG + Intronic
907676133 1:56519462-56519484 TGATGCACCAAGCACCAGCTAGG - Intronic
910105832 1:83630217-83630239 GGATGGAAAAATGAATAGCTAGG + Intergenic
910196177 1:84641863-84641885 GGATGAACAATTGACCACCTCGG + Intergenic
911976122 1:104497789-104497811 CCATGGACAAAGGATCATCTAGG - Intergenic
912372472 1:109184739-109184761 GCCTGGCCAAAGGACCAGCAAGG - Intronic
912686931 1:111775266-111775288 GGCTGGACACAGAAACAGCTAGG + Intronic
916049001 1:161021713-161021735 GGGTGGACAGAGGAACAGTTTGG - Intronic
917245543 1:172996852-172996874 AAATGGACAAAGGTACAGCTTGG + Intergenic
920692735 1:208159208-208159230 AGATGGACAAAGGACAACATTGG - Intronic
921364955 1:214364876-214364898 GGATCCAGACAGGACCAGCTGGG + Intronic
923073024 1:230583143-230583165 GTATGGAGAAAGGGCCAGGTCGG + Intergenic
923219272 1:231878462-231878484 GGATGGAGAAAAGACCAGTGAGG + Intronic
924052506 1:240092619-240092641 GGATGGACAAAGGACCAGCTCGG + Exonic
1067181174 10:43987077-43987099 GGATGGTCAAGGGATCAGATTGG - Intergenic
1069543907 10:69315811-69315833 GGATGGACAGAGCACTGGCTGGG + Intronic
1069613809 10:69793312-69793334 GGATTGACAAAGGTCCTTCTGGG + Intergenic
1070443281 10:76467491-76467513 GGTTGGACAAAGGAGCAGGCAGG + Intronic
1072030367 10:91515228-91515250 GGATGGAAAAAAGACCAGGATGG + Intergenic
1072113142 10:92342583-92342605 GGATGGCTAAAGGACCTTCTTGG + Intronic
1074372893 10:112914602-112914624 GGATGGACAGATGAACAGATAGG - Intergenic
1075659975 10:124186712-124186734 TATTGGACAAAGGACCACCTTGG - Intergenic
1076237067 10:128871636-128871658 GGATGGGGAAAGGAGCAGCAGGG + Intergenic
1076414636 10:130277124-130277146 CAGTGGACAATGGACCAGCTAGG + Intergenic
1078159198 11:8826230-8826252 GGATGGTCAGAGCCCCAGCTGGG - Intronic
1080581168 11:33645254-33645276 GGCTGGACACAGGACCATTTAGG + Intronic
1081616576 11:44594906-44594928 GCTTGGTCAAAGGACCAGCTGGG - Intronic
1081643396 11:44773773-44773795 GGATGGACACAAGACCAGCCTGG + Intronic
1083571404 11:63763874-63763896 GGAGGGACAAAGGACCGCATTGG + Intronic
1084793015 11:71486703-71486725 GGATGGACAAAGGGAGAGATGGG - Intronic
1085703797 11:78768309-78768331 GGTTGGAAATAGAACCAGCTGGG - Intronic
1085793369 11:79515478-79515500 GGATAGACAAAGAGCCAACTTGG + Intergenic
1088267074 11:107998057-107998079 AGAGGGAAAAATGACCAGCTGGG + Intergenic
1088373508 11:109116577-109116599 GGTTGGGCAAAGCACCAGGTCGG + Intergenic
1090990659 11:131814386-131814408 GGTTCGGCAAAGGACCAGCTGGG - Intronic
1096537565 12:52285210-52285232 GGAAGGACCAGGGCCCAGCTTGG + Intronic
1099318790 12:81118931-81118953 GCATGGAGAAAGGACCAACCTGG + Intronic
1100811447 12:98342817-98342839 AGAGAGAAAAAGGACCAGCTTGG - Intergenic
1101548373 12:105738484-105738506 GGATTGGCAAGGGAACAGCTTGG + Intergenic
1101549029 12:105744733-105744755 GGATTGGCAAGGGAACAGCTTGG + Intergenic
1101828667 12:108240533-108240555 GGAAGGGCAAAGGTACAGCTCGG + Exonic
1102218443 12:111178538-111178560 GGATTTGCAAGGGACCAGCTGGG + Intronic
1104825692 12:131707727-131707749 GGATGGACTAAAAACCGGCTAGG - Intergenic
1104974973 12:132548254-132548276 GGAGGGACACAGGCCCAGGTGGG + Intronic
1110395236 13:75022576-75022598 TGATGGAGAAAGCACCATCTGGG - Intergenic
1111520292 13:89393406-89393428 GGATGAACAATGGACCAGGCAGG - Intergenic
1112475930 13:99730697-99730719 GCATGGACACAGGACCAGGGAGG + Intronic
1113728320 13:112622367-112622389 GGAAGGACACAGGGACAGCTAGG - Intergenic
1116869393 14:50057036-50057058 GGATGGACAATGGAATGGCTTGG + Intergenic
1118380614 14:65214715-65214737 GGATGGACCAAGCCCCAGCATGG - Intergenic
1120988869 14:90357347-90357369 GGATGGACAGTGGAGCAGTTGGG - Intergenic
1121576695 14:94994839-94994861 GGATGGAGACAGGACAAGCAAGG - Intergenic
1121597853 14:95179532-95179554 GGATGGAGGAAGGACGTGCTCGG + Intergenic
1121856822 14:97277901-97277923 GGCTGGACAAAGGAACGGCAGGG + Intergenic
1125141310 15:36410696-36410718 GGATGAGAAAAGGAGCAGCTTGG + Intergenic
1125686890 15:41568790-41568812 GGACAGAAAAAGGTCCAGCTGGG - Intronic
1126384545 15:48080641-48080663 GGCTGGAGAGAGGACCAGCCAGG + Intergenic
1129072728 15:72964408-72964430 AGATGGAAAAGGGATCAGCTGGG + Intergenic
1131324550 15:91429833-91429855 GGGTGAACAAAGAAGCAGCTTGG + Intergenic
1133812767 16:9173996-9174018 GGAAGGACCAATGACCAGATAGG + Intergenic
1136394855 16:29987277-29987299 GGCTGTACAAAGGAGCAGGTAGG - Exonic
1137365154 16:47853715-47853737 GGCGGGCCAAAGGACCAGCTGGG + Intergenic
1139380862 16:66529806-66529828 GGATGGACAGAGGGACAGCAGGG - Intronic
1139432316 16:66917820-66917842 GGATGGACTAAGGTACAGCCAGG - Intronic
1139707445 16:68751095-68751117 GGATGGAGAAAAGACTGGCTTGG - Intronic
1140661474 16:77194125-77194147 GGATGGACAAAGGAACAAGTAGG - Intronic
1142068825 16:88078040-88078062 GGAGACAGAAAGGACCAGCTGGG + Intronic
1142510319 17:388959-388981 TGAGGGGCAAAGGACCAGCTTGG - Intergenic
1142600595 17:1051755-1051777 TGATGGAGAATGGCCCAGCTGGG - Intronic
1145299644 17:21623910-21623932 AGAAGGACGAAGGCCCAGCTAGG + Intergenic
1145350639 17:22079357-22079379 AGAAGGACGAAGGCCCAGCTAGG - Intergenic
1146672930 17:34754327-34754349 GGAGGGACAAAGGAGCACGTTGG + Intergenic
1147648085 17:42045965-42045987 GCAGGGACAAAGTAACAGCTTGG - Intronic
1148464452 17:47856626-47856648 AGATGGACAAAAGACCAGGAAGG + Intergenic
1149335669 17:55633221-55633243 GGGTGGACACAGGCCCAACTGGG - Intergenic
1149403643 17:56324842-56324864 GGGTGGCCAAAGGAAGAGCTTGG - Intronic
1150734218 17:67722528-67722550 GGATGCAAAAATCACCAGCTGGG - Intronic
1151719654 17:75847861-75847883 GGATAGACATAGGCCCCGCTGGG + Exonic
1151832880 17:76565921-76565943 GGATGAGCCAAGGACAAGCTGGG + Exonic
1152130943 17:78476118-78476140 GGGTGGAGAAAGGCCCTGCTTGG - Intronic
1152135094 17:78499125-78499147 AGATGGAGAAAGGAAGAGCTGGG + Intronic
1152150869 17:78600203-78600225 GGCTGGACAAAGGACCTCCTAGG + Intergenic
1157602228 18:48901382-48901404 GGATGGACAGATGAACAGATGGG + Intergenic
1160755585 19:755325-755347 GGATGGGCAAAGGAACACCGTGG - Intronic
1161128656 19:2574795-2574817 GGATGGAACAAGGCCCAGCCTGG - Intronic
1161544032 19:4868914-4868936 GGCTGGACAAAGCCCCAGTTGGG - Intergenic
1166264293 19:41668349-41668371 TGAAGGACAAAAGACCAGATGGG + Intronic
1166704678 19:44902162-44902184 GGATGGACAAAGCTCCAGCTTGG - Intronic
1168086890 19:54054731-54054753 GGATGGACAAATGAGTGGCTGGG + Intronic
926344608 2:11933853-11933875 GGATGGACAAAGGAGAGACTCGG + Intergenic
927887125 2:26725437-26725459 GCATGGACATAGCCCCAGCTTGG - Intronic
929536233 2:42786100-42786122 GGAGGGACAAAGGAAAAGTTGGG + Intronic
932846570 2:75141604-75141626 GGGTGGACAAAGGCATAGCTTGG - Intronic
933495841 2:83049352-83049374 GGATGTACACAGGTCCATCTAGG - Intergenic
938164643 2:129016201-129016223 GGATGGACAAAGTACAAAATAGG - Intergenic
938947716 2:136228140-136228162 GGATGGACAAATGGACAGATTGG - Intergenic
940806663 2:158195032-158195054 AGATGGACCCAGGACCAGCATGG - Intronic
945027990 2:205637570-205637592 GGGTGGAGAGAGGACAAGCTTGG - Intergenic
947737707 2:232465247-232465269 TGCTGGACACAGGCCCAGCTCGG + Intergenic
947863512 2:233379675-233379697 GGATGGACAGAGAACAAACTTGG + Intronic
1169687098 20:8287649-8287671 GGATGTACAAAGAATCAGCATGG + Intronic
1170928248 20:20745247-20745269 GGTTGGCCAAAAGACCAGCAAGG - Intergenic
1171560888 20:26124347-26124369 AGAAGGACAAAGGCCCAGCTAGG - Intergenic
1172324323 20:34022681-34022703 GGACGGAAAAAGTACCATCTAGG + Intronic
1173024971 20:39299084-39299106 GGATGGAGACAGGAGGAGCTGGG + Intergenic
1173708956 20:45137958-45137980 GCATTGACAAAGTACCAGCCAGG - Intergenic
1175422516 20:58843471-58843493 GGTGGGGCAAAGGGCCAGCTGGG - Intronic
1176650329 21:9540725-9540747 AGAAGGACAAAGGCCCAGCTAGG + Intergenic
1178270247 21:31182851-31182873 TGATGTATGAAGGACCAGCTAGG - Intronic
1179308019 21:40172550-40172572 GGAGGGACACAGGAGCTGCTGGG - Intronic
1180046210 21:45306915-45306937 GGAGGGACAGTGGACCAGCCAGG - Intergenic
1181172582 22:21018081-21018103 GGAGGAACAAGGGACCCGCTGGG - Intronic
1183196246 22:36355612-36355634 GCATAGACCAAGGACCTGCTAGG + Intronic
1183313416 22:37124003-37124025 AGAGGGACACTGGACCAGCTTGG + Intergenic
1184240484 22:43209050-43209072 GGATGGGCAAGGGACCGGCCTGG - Intronic
1185193239 22:49452003-49452025 GCCTGGACAAAGGAACAACTGGG - Intronic
949507644 3:4742075-4742097 GGTTGGCTCAAGGACCAGCTTGG + Intronic
949549259 3:5098678-5098700 GAAGGGACAAAGGGCAAGCTCGG - Intergenic
949693879 3:6671281-6671303 GGAGGGGCAATGGACCAGGTTGG + Intergenic
949929916 3:9070593-9070615 GGATGGACAGATGAACAGATGGG + Intronic
950104333 3:10378708-10378730 GAAAGGACAAGGGACCACCTAGG - Intronic
953534893 3:43769914-43769936 GGCTGGAAAAAGGAGCAGCCTGG - Intergenic
954297395 3:49681849-49681871 GGAGGGTGAAAGGGCCAGCTAGG - Intronic
954829326 3:53405958-53405980 CAAAGGACAAAGGACAAGCTGGG + Intergenic
958483364 3:94673761-94673783 GGCTGGAGAGAGGACCAGATTGG + Intergenic
967135981 3:186512970-186512992 GAATGGCCAAAGATCCAGCTGGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
970373309 4:15430976-15430998 GGAAAGACAAAGGACAAACTGGG + Intronic
971700195 4:29962939-29962961 GCATGGCCAAAGAACCAGCCTGG - Intergenic
974523701 4:63019472-63019494 GGTTAGACAAAGAACCAACTGGG - Intergenic
978229065 4:106376098-106376120 TGATATACAAAGGACCAACTTGG - Intergenic
978405778 4:108377338-108377360 GGATGGACAAACAAGCAGCTGGG - Intergenic
983494023 4:168422617-168422639 CGATTGACATTGGACCAGCTCGG - Exonic
985565886 5:617050-617072 CGATGGCCAAAGGACCAGGAGGG - Intronic
985897723 5:2759031-2759053 GGAAGGGGAAAGGACCTGCTAGG - Intergenic
986179100 5:5376700-5376722 AGATGGACACAAAACCAGCTGGG + Intergenic
989542146 5:42629965-42629987 AGATTGTCAAAGGACCAGCGGGG - Intronic
990318964 5:54611323-54611345 GGGTGGGGAAAGGACCATCTTGG - Intergenic
998396426 5:141821528-141821550 AGATGGGCAGAGGACCAGCTGGG - Intergenic
1004447397 6:15712647-15712669 GGATTGAGAAAGGAACACCTAGG + Intergenic
1018209251 6:161464307-161464329 GGCTTGAGAAAGTACCAGCTGGG - Intronic
1020353898 7:7255937-7255959 GGCTGGACAAAGGGACTGCTGGG - Intergenic
1020434073 7:8143517-8143539 GTGTTGACAAAGGACCAGATAGG + Intronic
1024474128 7:49792533-49792555 GGAAGGAAAAAGGACTGGCTGGG + Intronic
1024839434 7:53567734-53567756 GGTTGGTCAAAGGACAAGCTAGG + Intergenic
1025276947 7:57591020-57591042 AGAAGGACAAGGGCCCAGCTAGG + Intergenic
1026286328 7:68966315-68966337 GGATGGAGAAAGGAGCAGGCAGG + Intergenic
1026322726 7:69281723-69281745 TGATGCACAAAGCATCAGCTAGG - Intergenic
1026422093 7:70250304-70250326 GCATGGTCTAAGGACCAGATAGG + Intronic
1029403080 7:100357348-100357370 AGAGGGACAGAGGACAAGCTGGG + Intronic
1029405696 7:100373089-100373111 AGAGGGACAGAGGACAAGCTGGG + Intronic
1031123729 7:117749469-117749491 GGATGGAGACAGGAGCTGCTGGG - Intronic
1031124391 7:117756855-117756877 GGGTGGAGGAAGGAACAGCTGGG - Intronic
1031576374 7:123419902-123419924 GGATCCACAGAGTACCAGCTGGG + Intergenic
1034043620 7:147905298-147905320 GCCTGGACAATGAACCAGCTGGG - Intronic
1035766901 8:2113575-2113597 GGATGGAGGAAGGACCGACTGGG + Intronic
1036725183 8:11214223-11214245 GGATGAAGAAAGGTCAAGCTTGG + Intergenic
1036789722 8:11709479-11709501 GGATGGACAAAGGAGACGCCGGG + Intronic
1036966174 8:13300730-13300752 GAATGGACAAATGGCCAGCCAGG + Intronic
1038440771 8:27569574-27569596 GGATGGATGAAGGACTAGATGGG + Intergenic
1042038985 8:64571914-64571936 TGAAGGACAAATGACCAACTGGG - Intergenic
1042374300 8:68031644-68031666 AGTTGGACAAAGAAGCAGCTAGG - Intronic
1043509068 8:80931891-80931913 GCATGGTCAAGGGACCAGCAGGG - Intergenic
1044158714 8:88885480-88885502 GGGTGGCCAAATGACAAGCTTGG + Intergenic
1044559811 8:93601888-93601910 GGATTGACCAAGGACAAGGTGGG + Intergenic
1044739906 8:95315491-95315513 GGGTGGAAAAATGACCAGCTTGG + Intergenic
1044843614 8:96359374-96359396 GAAGGGCCAAGGGACCAGCTGGG - Intergenic
1045192022 8:99892986-99893008 GGCTGGGCAAAGGAGCAGTTAGG - Intronic
1049153664 8:141053995-141054017 GGATGGATGAAGGAACAGATGGG + Intergenic
1049907179 9:228964-228986 GAATGCAAAAAAGACCAGCTAGG - Intronic
1049979727 9:892901-892923 GGAAGGAGAAAGGAGCAGCAAGG - Intronic
1051505051 9:17817826-17817848 GGATGGGTAAAGGGCCTGCTGGG + Intergenic
1055705071 9:78990249-78990271 GGATAGATAAAGGAGCATCTAGG - Intergenic
1057260795 9:93582128-93582150 GCATGGACACAGAAGCAGCTAGG + Intronic
1059468900 9:114488621-114488643 GGCTGGACACAGCACCTGCTCGG - Intronic
1060218781 9:121753698-121753720 GGATGTGCAAGTGACCAGCTGGG + Intronic
1060864067 9:126981023-126981045 GGGTGGAAAAATGACCAGCTAGG - Intronic
1203628069 Un_KI270750v1:44279-44301 AGAAGGACAAAGGCCCAGCTAGG + Intergenic
1186611631 X:11143680-11143702 GGAGGGAAAAAGAATCAGCTGGG + Intronic
1187944076 X:24409542-24409564 GGGTGGATAATGGCCCAGCTGGG - Intergenic
1189735624 X:44066813-44066835 GCTTGGGCAAAGTACCAGCTCGG + Intergenic
1194586962 X:95746939-95746961 GGATGGAGACTGGAGCAGCTGGG - Intergenic
1196065375 X:111458517-111458539 GGCTGGACACATGACCACCTAGG + Intergenic
1196739702 X:119013987-119014009 GGAAGGAGAAAGGTTCAGCTGGG - Intronic
1196812068 X:119636754-119636776 GGATGCCCAGAGGACCAGCAAGG - Intronic
1197187507 X:123604548-123604570 GTCTGGAGAAAGGAACAGCTAGG + Intronic
1197210453 X:123824069-123824091 GGTGGGACATAGGACCAGGTTGG + Intergenic
1198551423 X:137749371-137749393 GGAGGAACAAAGCACCAACTGGG + Intergenic
1200268509 X:154659745-154659767 GGATGGACTAATGACTAGGTAGG + Intergenic