ID: 924058285

View in Genome Browser
Species Human (GRCh38)
Location 1:240144895-240144917
Sequence CATGGAGTCATGAGTATATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924058285_924058291 18 Left 924058285 1:240144895-240144917 CCTGATATACTCATGACTCCATG 0: 1
1: 0
2: 1
3: 9
4: 104
Right 924058291 1:240144936-240144958 AGCCTACTAGCCGATACTTGAGG 0: 1
1: 1
2: 0
3: 2
4: 20
924058285_924058286 -6 Left 924058285 1:240144895-240144917 CCTGATATACTCATGACTCCATG 0: 1
1: 0
2: 1
3: 9
4: 104
Right 924058286 1:240144912-240144934 TCCATGATGCCAATTCCTTCTGG 0: 1
1: 0
2: 3
3: 12
4: 151
924058285_924058288 -5 Left 924058285 1:240144895-240144917 CCTGATATACTCATGACTCCATG 0: 1
1: 0
2: 1
3: 9
4: 104
Right 924058288 1:240144913-240144935 CCATGATGCCAATTCCTTCTGGG 0: 1
1: 1
2: 3
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924058285 Original CRISPR CATGGAGTCATGAGTATATC AGG (reversed) Intronic
905460666 1:38120831-38120853 GAGGGAGGCATGAGGATATCTGG - Intergenic
906541843 1:46592829-46592851 CATGTAATCATAAGTATATGAGG - Intronic
907428912 1:54399316-54399338 CATGGAGTCATGACTGACTCTGG - Intronic
907606475 1:55822742-55822764 CATACAGTCATGAAAATATCAGG + Intergenic
909354576 1:74693505-74693527 CAAGGGGTCAAGAGAATATCAGG - Intergenic
915057532 1:153148989-153149011 GAGGGAGCCATGGGTATATCAGG - Intergenic
917788253 1:178482719-178482741 CAAGGAGAGATGAGTATTTCCGG - Intergenic
918170106 1:181988404-181988426 TATGGAGTCATGAGTGTCTGGGG - Intergenic
919760991 1:201097931-201097953 AAGTGAGTCATGAGGATATCTGG - Intronic
921632432 1:217451957-217451979 CAGGGAGTTATGAGTAGTTCAGG + Intronic
923904768 1:238371529-238371551 CATGAAGTCATGATTATTTGTGG + Intergenic
924058285 1:240144895-240144917 CATGGAGTCATGAGTATATCAGG - Intronic
924317294 1:242811453-242811475 CACAGAGTCATGAGTACAGCAGG - Intergenic
1062805453 10:416343-416365 CATGGAGGCACGAGAACATCGGG + Intronic
1063987949 10:11527211-11527233 CAATGAGGCATGAGAATATCTGG + Intronic
1066668975 10:37816948-37816970 CATGGTGTCCTGAGAATATAGGG - Intronic
1070230584 10:74562431-74562453 GATGGATTCAAGAGTATATTGGG + Intronic
1081267731 11:41047654-41047676 CAAGGAGTCATGAGCATTTCTGG - Intronic
1085047359 11:73361479-73361501 CATGTATCCATGATTATATCTGG + Intronic
1090177949 11:124668195-124668217 CATGGAGGCCTGAGTGTACCTGG - Intronic
1095998250 12:48107272-48107294 CAAGTAGTCATGAGTGTAGCTGG + Intronic
1096055807 12:48650996-48651018 TAAGGAGTCATGATTATATTGGG + Intergenic
1097725140 12:63066747-63066769 CATAGAGTCATGATTCTGTCAGG + Intergenic
1100732748 12:97490798-97490820 GATGGAGTCATGACAACATCTGG - Intergenic
1101330365 12:103752935-103752957 CATGGAGTAATGATTATTTCTGG + Intronic
1101471728 12:105003367-105003389 CAGGGAATCATGAGTTCATCTGG - Intronic
1102557917 12:113740976-113740998 CATGGAGTAATCAATATTTCTGG - Intergenic
1109016364 13:57020510-57020532 CATGGTGCCATGAGCATCTCTGG + Intergenic
1109826820 13:67732346-67732368 CATGTAGTAATTAGTATATCAGG - Intergenic
1112102865 13:96209488-96209510 CAAGGAGTCATGAGAATAGGTGG + Intronic
1112647779 13:101354841-101354863 CAGGGAGTCGTTAGTATGTCTGG - Intronic
1116458282 14:45143559-45143581 CATGGAATCAACAGTATGTCTGG + Intronic
1129618655 15:77122159-77122181 CATGGAGTCCTGAGTACTTTGGG - Intronic
1135184230 16:20300922-20300944 CATAAAGTCATGAGTATAACAGG + Intergenic
1137063431 16:35812328-35812350 CATGGAGTGCAGAGTGTATCAGG - Intergenic
1138330787 16:56213862-56213884 CATGGAGTCAGTAGTTTCTCTGG + Intronic
1144353964 17:14426772-14426794 CATGCAGGCATGTGTACATCTGG - Intergenic
1151448427 17:74182199-74182221 CATGGAGTCATGAGTCTGGAAGG + Intergenic
1151709869 17:75797864-75797886 CATGAAGTCCTGAGCAAATCTGG + Intronic
1153098000 18:1431020-1431042 CATGGAGACATGGGGATATGGGG + Intergenic
1158258176 18:55577040-55577062 CATGGAGATATGAGAATAGCAGG + Intronic
1166395690 19:42438906-42438928 CATGGACTCATGAGTATTTATGG - Intronic
1166464660 19:43021806-43021828 GATGGAGTCATGAGTGAAACAGG + Intronic
931710239 2:64983171-64983193 CATGGATACATAAGTATATTGGG + Intergenic
932412522 2:71555714-71555736 CATGTAGTCATGAGGAGCTCAGG - Intronic
932722638 2:74148745-74148767 CATGGAGTCATGAGAATGGAAGG + Intergenic
932828931 2:74969377-74969399 CAAAGAGCAATGAGTATATCAGG - Intronic
934489298 2:94748389-94748411 CATTGAGTGATGAGGATATGAGG - Intergenic
938240782 2:129741050-129741072 CATGGGAGCAGGAGTATATCTGG + Intergenic
945983286 2:216333649-216333671 CAGGGAGACATGAGTAAACCTGG - Intronic
1168843321 20:923926-923948 CTTGGAGTGATGACTATATGGGG - Intergenic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1170054243 20:12181875-12181897 CCTGAGGTCAGGAGTATATCAGG + Intergenic
1171218796 20:23374584-23374606 CATGGAGTCCTGAGTTGCTCTGG - Exonic
1174741933 20:53023027-53023049 TATGGAGTCAGGAGCAGATCTGG - Intronic
1177884360 21:26731279-26731301 CATGGGGTCAAGAGTGTAACTGG - Intergenic
1178554026 21:33570166-33570188 CAAGGAGTCAGGAGTACAACAGG - Intronic
1182031508 22:27162854-27162876 CAGGGAGCCATGAGGCTATCTGG + Intergenic
1182993122 22:34787103-34787125 CATTGTATCATGATTATATCAGG + Intergenic
1183135053 22:35879145-35879167 GAGGAAGACATGAGTATATCTGG + Intronic
949772622 3:7595675-7595697 GAAGGAGTCATGAATATAACTGG + Intronic
951022513 3:17796617-17796639 CATCCAGTCATGAATATATTGGG - Intronic
952010929 3:28900557-28900579 CAGGGAGGAATGAGTATATATGG - Intergenic
953388061 3:42517971-42517993 GATGGGGTGATGAGTATATTGGG + Intronic
955659176 3:61278179-61278201 AATGGAGTCCTGAGGAAATCAGG + Intergenic
962381256 3:134899891-134899913 CAGAGAGTCATGACTATACCTGG + Intronic
963340974 3:144033157-144033179 CATGGGGACATGAGTACTTCAGG + Intronic
963510558 3:146242617-146242639 CATAGAATCATGGGTTTATCTGG + Intronic
965723854 3:171692461-171692483 GATGGAGGAATGAGTATCTCTGG + Intronic
966638795 3:182165536-182165558 CATACAGTCATGAGTAAAGCAGG - Intergenic
966872696 3:184301637-184301659 CATGGGGTCATGAGTATGTCAGG + Exonic
969884638 4:10204447-10204469 CAAGGAGTCATCAGGAGATCTGG - Intergenic
970280114 4:14445720-14445742 CATGGGGTCACGGGTATATCTGG + Intergenic
975421895 4:74174507-74174529 CATGAAGCCATTATTATATCAGG + Exonic
982729313 4:158938821-158938843 TATGGAGTAATGAGCACATCAGG + Intronic
985476582 5:82961-82983 TATGAATTCATGAGTATTTCTGG + Intergenic
986140185 5:5022381-5022403 CATGTAGTTATTTGTATATCTGG - Intergenic
994671160 5:102763440-102763462 CATGGAGTGAAGAGTATAGGAGG + Intronic
996874731 5:128228221-128228243 CAAGGAGTCATAAGTGTATTAGG - Intergenic
1006593008 6:35171889-35171911 CTTGGTGACATGACTATATCTGG + Intergenic
1007433549 6:41791069-41791091 TGTCCAGTCATGAGTATATCAGG - Exonic
1008160745 6:48072284-48072306 CATGGACTCATGGATATTTCTGG + Intergenic
1009236241 6:61127648-61127670 CGTGGACTCTTGAGTATAGCTGG - Intergenic
1009760367 6:67997253-67997275 CATGGATTCATTAGAAAATCAGG + Intergenic
1010524326 6:76881647-76881669 CATGCAGTCATGAGAACATCTGG + Intergenic
1011526600 6:88272074-88272096 CAGGGAGTCAAGAGTAAATGGGG + Intergenic
1012985490 6:105871500-105871522 CATGGAGTCATGTGTAGACAGGG - Intergenic
1014488972 6:122038044-122038066 CATGGAGCTATTTGTATATCCGG + Intergenic
1015300543 6:131648872-131648894 CTTGGAGTCATCAGCATATTAGG - Intronic
1020020714 7:4866315-4866337 CATGGAGTCAAGAGTCTAGCAGG - Intronic
1021057874 7:16073046-16073068 CTTGCAGTTATGAGTATTTCTGG + Intergenic
1021283839 7:18754426-18754448 CTGGGAGTCATGAGCATTTCTGG - Intronic
1023048728 7:36233582-36233604 CCTTGAAGCATGAGTATATCGGG - Intronic
1032355118 7:131203897-131203919 CATGGAGTCATCAATAAATGAGG - Intronic
1041519265 8:58737208-58737230 AATTGAGTAAGGAGTATATCTGG - Intergenic
1044788449 8:95821770-95821792 CAGGGAGTCATGAAAATATATGG + Intergenic
1046616974 8:116488509-116488531 CAAGGAGTGATCAGTATATTAGG - Intergenic
1046738067 8:117798784-117798806 CAAGGAATAATGAGTATATTGGG - Exonic
1047468592 8:125144502-125144524 CATGGACTCATGAGCTTATCCGG - Intronic
1052684818 9:31742038-31742060 CATTTAGACATGAGGATATCAGG + Intergenic
1052955984 9:34253613-34253635 CATGGAAGCATGAGAGTATCGGG + Exonic
1053414034 9:37935101-37935123 CATGGAGTTATGCGAATATTTGG + Intronic
1053668487 9:40335892-40335914 CATTGAGTGATGAGGATATGAGG + Intergenic
1053918284 9:42962192-42962214 CATTGAGTGATGAGGATATGAGG + Intergenic
1054379627 9:64475944-64475966 CATTGAGTGATGAGGATATGAGG + Intergenic
1054516124 9:66040401-66040423 CATTGAGTGATGAGGATATGAGG - Intergenic
1055331911 9:75193429-75193451 CAGGGATTCATGATTATATTTGG - Intergenic
1058445645 9:105052567-105052589 GAAGGAGCCATGAGTATCTCAGG + Intergenic
1059742531 9:117166000-117166022 CATGGAGTAAAAAGTATCTCTGG + Intronic
1185973290 X:4688390-4688412 CATGAAGTCACAAGTTTATCCGG - Intergenic
1186091897 X:6057983-6058005 CATGGGGTAATGAACATATCCGG + Intronic
1188956225 X:36437328-36437350 CACTGGGTCATGAGTATGTCTGG + Intergenic
1195980244 X:110569586-110569608 GAAGGAGTCATGTGAATATCTGG + Intergenic
1198012887 X:132577109-132577131 CATGGAGTGATGTGTACATTAGG + Intergenic
1201220788 Y:11767962-11767984 CACAGAGTCATGAGTACAGCAGG - Intergenic