ID: 924062680

View in Genome Browser
Species Human (GRCh38)
Location 1:240192512-240192534
Sequence CTTGTGGGTTATTGTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 299}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924062680_924062684 3 Left 924062680 1:240192512-240192534 CCAACAAAACAATAACCCACAAG 0: 1
1: 0
2: 1
3: 26
4: 299
Right 924062684 1:240192538-240192560 AGTAAATAACTAAAATAAGGCGG 0: 1
1: 0
2: 9
3: 103
4: 911
924062680_924062683 0 Left 924062680 1:240192512-240192534 CCAACAAAACAATAACCCACAAG 0: 1
1: 0
2: 1
3: 26
4: 299
Right 924062683 1:240192535-240192557 ACAAGTAAATAACTAAAATAAGG 0: 1
1: 0
2: 7
3: 193
4: 1381
924062680_924062685 27 Left 924062680 1:240192512-240192534 CCAACAAAACAATAACCCACAAG 0: 1
1: 0
2: 1
3: 26
4: 299
Right 924062685 1:240192562-240192584 GTAAGAAATACAAGTCTTAAAGG 0: 1
1: 0
2: 0
3: 23
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924062680 Original CRISPR CTTGTGGGTTATTGTTTTGT TGG (reversed) Intronic
900254108 1:1688127-1688149 CTTGTGGGCTGTTGTTTTACTGG - Intronic
901814006 1:11783751-11783773 CTGGTCGTTTACTGTTTTGTGGG + Intronic
902357941 1:15920787-15920809 CTTGTGGCTTAGGATTTTGTTGG + Intronic
903373376 1:22850956-22850978 TTTGTAGGCTATTGTTTTGTGGG + Intronic
903752391 1:25633846-25633868 CTATTGTGTTATTGTTTTATAGG + Intronic
903926125 1:26831952-26831974 CTTGTGGCTTATGGTCTAGTGGG - Intronic
906028913 1:42700913-42700935 CTTGTGGTTTAGGGTTTTCTGGG - Exonic
906587163 1:46989241-46989263 TTTGTCGATTATTGTTGTGTAGG - Intergenic
908960380 1:69690664-69690686 CTGGTGTGTTATTGTATAGTGGG - Intronic
909521098 1:76568627-76568649 CCTGTCTGTTATTGTTTGGTTGG - Intronic
911775592 1:101807452-101807474 CCTGTTGGTTCTTGTTTTTTTGG + Intronic
914465257 1:147922487-147922509 CTTTTGGATTATTTTTTTGGTGG - Intergenic
918811586 1:189128359-189128381 CATGTGTGTTATTGAGTTGTGGG - Intergenic
919377754 1:196815867-196815889 CTTGTCTGTTATTGGTGTGTAGG + Intergenic
919387269 1:196937761-196937783 CTTGTCTGTTATTGGTGTGTAGG + Intronic
919772872 1:201173976-201173998 CTTGTGGGCCATAGTTTTGCTGG + Intergenic
920896497 1:210056320-210056342 CTTGTGGAATATTTTTTTGGTGG - Intronic
921642389 1:217570634-217570656 TTTGTTGGTTATTAGTTTGTTGG - Intronic
921976979 1:221213548-221213570 CTTCTGGGTAATTGCTTTCTTGG + Intergenic
922177589 1:223208699-223208721 TTTTAGGGTTATTGTTTGGTGGG - Intergenic
922251591 1:223854069-223854091 CCTGTGGGTTACAGTATTGTGGG - Intergenic
923422357 1:233829356-233829378 CTTCTAGGTTATTTTTTTTTTGG + Intergenic
923678700 1:236101880-236101902 CATGTGGGTGAGTGTTATGTGGG + Intergenic
923767904 1:236909995-236910017 TTGGAGGGTTATTGTTTAGTTGG - Intergenic
924062680 1:240192512-240192534 CTTGTGGGTTATTGTTTTGTTGG - Intronic
924480230 1:244424295-244424317 TGTGTGGGTTTTTGTTTTTTTGG - Intronic
1063795888 10:9513564-9513586 CTGCTGGGATTTTGTTTTGTTGG + Intergenic
1063927112 10:10991193-10991215 CTTGTGGGTATTTGTGGTGTTGG + Intergenic
1063971987 10:11387495-11387517 CCTCTGGGTTTTTGTTGTGTTGG - Intergenic
1066149689 10:32602456-32602478 CTTGTGTTTTATGTTTTTGTGGG + Intronic
1066667439 10:37799323-37799345 CTTGTGGTTTATAGTTTTTCTGG - Intronic
1067970293 10:50962285-50962307 CTTGTGGCTTAATGTTCAGTAGG + Intergenic
1069122415 10:64583559-64583581 CTTGTCTGTTATTGGTGTGTAGG + Intergenic
1073392454 10:103191029-103191051 GTTGTGGGTTTTTGTTTTTGGGG + Intronic
1075720457 10:124583175-124583197 CTTGTTGCTTATAGTTTTGGTGG + Intronic
1076559297 10:131350688-131350710 ACTGTCGGCTATTGTTTTGTTGG + Intergenic
1077497701 11:2894401-2894423 CTTTTGGGTTTTTGCTTTTTGGG + Intronic
1078823047 11:14901736-14901758 CTTGTAGGTTTATATTTTGTAGG + Intergenic
1079502918 11:21122040-21122062 CTAGTGTTTGATTGTTTTGTTGG + Intronic
1081064679 11:38525859-38525881 TTTTTGTGTTATTGTTTTATAGG - Intergenic
1082035096 11:47639203-47639225 CTTGTAGGTTTTTCTTCTGTTGG + Intronic
1084633927 11:70377089-70377111 TTTGTGGGTTTTTTTTTTGCGGG - Intronic
1085342089 11:75738769-75738791 CTTGTGGGTTTTTTTTTGGGGGG - Intergenic
1085378157 11:76086764-76086786 CTTGCGGGTCTTTGTTTTTTTGG - Intronic
1087607237 11:100391797-100391819 ATTATGGCTTATTGTTTTGATGG + Intergenic
1088518418 11:110665075-110665097 CCTATGGGTTATTGTTTTATGGG - Intronic
1089043620 11:115479416-115479438 CTTGTGTGTTTTTCTTTTTTTGG - Intronic
1090466347 11:126937896-126937918 TTTTTGGTTTTTTGTTTTGTGGG - Intronic
1091789269 12:3262178-3262200 TTTGTGGGTGTCTGTTTTGTGGG + Intronic
1093868334 12:24256009-24256031 CTAGTTGGTTAATGTTTTCTTGG + Intergenic
1094671619 12:32575789-32575811 GTTGTTTGTTGTTGTTTTGTTGG + Intronic
1098418088 12:70259685-70259707 TCTGTTGGATATTGTTTTGTTGG + Intronic
1099368428 12:81798789-81798811 CTTCTGGGTGATTGTTATGTTGG - Intergenic
1101046929 12:100817068-100817090 CCTTTGGGTCATTATTTTGTAGG + Intronic
1101621768 12:106395676-106395698 CCTGTGGGGTTTTGTTTTTTTGG + Intronic
1101792643 12:107941912-107941934 CTTGTTTGTTATTGTTTTTGTGG - Intergenic
1104533144 12:129591533-129591555 CTTTTGGGTTTTTTTTTTCTCGG + Intronic
1106036609 13:26050498-26050520 CTTCTGGCTTATTATTTGGTCGG - Intronic
1107064395 13:36196947-36196969 CTTTTAGCTTATTGATTTGTAGG - Intronic
1107171533 13:37348008-37348030 CTGGTGGTTTCTTTTTTTGTGGG - Intergenic
1108123232 13:47212510-47212532 CTGGTGGGTTATGGTGTTCTTGG + Intergenic
1108434627 13:50389751-50389773 CTTATGAGTTATTATTTTGGAGG + Intronic
1109811834 13:67523094-67523116 TTTGTGTGTTTTTGTTTTGGGGG - Intergenic
1110390369 13:74966675-74966697 CTTGTGTTTTATAGTTTTGAGGG - Intergenic
1111313974 13:86527515-86527537 CTTGTAGATTATTTTTTTCTGGG + Intergenic
1111906253 13:94259252-94259274 CTTGTTGGTTATTGGTTTAGGGG - Intronic
1112399146 13:99060618-99060640 CATGTCTGTTATTGTTATGTTGG - Intronic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1113942766 13:114027016-114027038 CTTGGGGGTTTTTGTTTTTTTGG - Intronic
1115383504 14:32768130-32768152 CTTTGGGATCATTGTTTTGTGGG - Intronic
1115803843 14:37028917-37028939 CCAGTGGGATATAGTTTTGTAGG + Intronic
1117847119 14:59922993-59923015 CTGGTGGCTTCTGGTTTTGTGGG + Intronic
1118463759 14:66012907-66012929 CTTGTGGTTTAGGGTTTTCTGGG + Intergenic
1118832036 14:69442879-69442901 ATTTTGGGTTTTTGTTTTGATGG + Intronic
1118952169 14:70444950-70444972 CTTCTTGGATCTTGTTTTGTTGG - Intergenic
1120123391 14:80710819-80710841 GTTTTGGGTTAATGTTTTGCTGG - Intronic
1120369677 14:83617258-83617280 CTTGTTGGTCTTTGTTCTGTAGG + Intergenic
1120794359 14:88616242-88616264 CTTGTCTGTCATTGTTTTTTAGG - Exonic
1122504377 14:102222333-102222355 CTGGGGGGTTCTTGCTTTGTTGG - Intronic
1124477550 15:30047905-30047927 CTTGTGGTTAATAGTTTTGCTGG + Intergenic
1124813121 15:32961576-32961598 TTAGTGGGTTTTTGTTTGGTTGG - Intronic
1125547203 15:40514458-40514480 ATGGTGGTTTTTTGTTTTGTTGG - Intergenic
1125574596 15:40746646-40746668 CTTGTGGTTTCTGGTTTTCTGGG - Intronic
1125983069 15:44021440-44021462 CTTTTGGGTTATTGAGTTGTAGG - Intronic
1126579061 15:50226296-50226318 CTTATGAGGTAATGTTTTGTGGG + Intronic
1127767860 15:62205168-62205190 CTTGTCAATTTTTGTTTTGTTGG + Intergenic
1127856003 15:62954023-62954045 CTTGTGGTTTAGGGTTTTCTGGG - Intergenic
1129768279 15:78184170-78184192 TTTCTGGGGTTTTGTTTTGTTGG + Intronic
1130782726 15:87060337-87060359 CCTTTTGGTTATTGATTTGTAGG - Intergenic
1131673130 15:94642619-94642641 CTTGAGGATTGTGGTTTTGTTGG - Intergenic
1132027949 15:98418914-98418936 CTTGTGTGTAATTTTTTTTTCGG - Intergenic
1135026769 16:19004865-19004887 CTTTTGGGTTTTTTTTTTCTTGG + Intronic
1137752588 16:50877844-50877866 CTTGTGTGGGACTGTTTTGTAGG + Intergenic
1139839908 16:69869974-69869996 CTCTTGGGCTATTTTTTTGTTGG - Intronic
1142339169 16:89509242-89509264 CTTTTAGGTTGTTGTTTTTTCGG + Intronic
1142953968 17:3507715-3507737 CATGTTGGTTATTGTTTTGTAGG - Intronic
1143726612 17:8851520-8851542 TTTGTGGTTTTTTGTTTGGTTGG - Intronic
1144132950 17:12265773-12265795 GTTGTGGGTTGCTGTTTTATAGG + Intergenic
1149963485 17:61137836-61137858 GTGATGGGTTTTTGTTTTGTGGG + Intronic
1152384233 17:79960762-79960784 TTTTTGGGTTTTTGTTTTTTGGG - Intronic
1153071753 18:1114268-1114290 TTATTGGGTTATTGTTTTATAGG + Intergenic
1155332900 18:24735760-24735782 TTTGTGTGTTTTTGTGTTGTGGG + Intergenic
1156708359 18:39911895-39911917 CTTCTAGGTTATTCTTCTGTTGG - Intergenic
1159645439 18:70912902-70912924 TTTGTCTGTTATTGTTGTGTAGG + Intergenic
1160785065 19:896541-896563 CGTGTGGGTAATTGTGTTTTGGG - Exonic
1164311311 19:24048677-24048699 TTTGTTGGTTTTTGTTTTTTGGG + Intronic
1165053885 19:33161355-33161377 ATTGTGGGTTCTTGCTGTGTTGG - Intronic
1165426307 19:35747598-35747620 TTTGTGGGTTTTTTTTTTGGGGG + Intronic
1167500159 19:49841793-49841815 CTTTTTGGTTTTTTTTTTGTGGG - Intergenic
1168228569 19:55014273-55014295 TTTGTGTTTTTTTGTTTTGTTGG + Exonic
926495706 2:13584430-13584452 TTTGTGGGTTTTTTTTTTTTTGG - Intergenic
927195834 2:20546123-20546145 ATTGTGAGTTCTTGTTTTCTGGG + Intergenic
927329370 2:21843800-21843822 TTTGTGTGTTTTTTTTTTGTGGG + Intergenic
931237577 2:60424395-60424417 CTTGTGGGTTGTTGGATTGAGGG - Intergenic
934096093 2:88606139-88606161 CTTGAGGCATTTTGTTTTGTAGG - Intronic
934869177 2:97845047-97845069 CTTGTAAGTTACTCTTTTGTTGG - Intronic
935623937 2:105152886-105152908 CTTTTGGCTTATTTTTTTTTAGG + Intergenic
936528252 2:113257043-113257065 CTTGGAGGTTATGGTTTTATGGG + Intronic
937172577 2:119890601-119890623 CTTATAGGTTGTTGTTTTGATGG + Intronic
942587525 2:177499554-177499576 ATTTTGATTTATTGTTTTGTAGG + Intronic
942922262 2:181389978-181390000 TTTTTGGTTTATTGTTTTCTGGG - Intergenic
944777798 2:202986030-202986052 TTTGTGGGGTTTTGTTTTATTGG - Exonic
946847785 2:223875396-223875418 TTTGTGGGTTCTGTTTTTGTGGG - Exonic
948746453 2:240097859-240097881 TGTGTGTGTTATTGTTTTATAGG - Intergenic
1168905592 20:1400993-1401015 TTTGTGGGTTTTTTTTTTTTTGG + Intergenic
1171088402 20:22261181-22261203 CTTGTGGTGTGTTGTTTTGCTGG - Intergenic
1171179076 20:23078483-23078505 CTTGTGGGTGTGTGTCTTGTGGG + Intergenic
1174515052 20:51085548-51085570 CTTGAGGGGTTTTGTTTTTTTGG + Intergenic
1174957159 20:55110959-55110981 CTTGTGGGTAGTACTTTTGTCGG + Intergenic
1175592640 20:60205651-60205673 AATGGGGGTTATTGTTTAGTGGG - Intergenic
1175946737 20:62562420-62562442 CTTGTGGGGTGTTGGTTTCTTGG + Intronic
1177111275 21:17032533-17032555 CTCCTAGGTTTTTGTTTTGTTGG - Intergenic
1177509858 21:22072461-22072483 CTTGTAGGTTTTTGTTTTTAGGG + Intergenic
1177636435 21:23793161-23793183 CTGGTGTGTGATTGATTTGTGGG - Intergenic
1177984574 21:27958502-27958524 CTTATTTGTTATTGATTTGTAGG - Intergenic
1178121378 21:29473621-29473643 CTTGTGTGCTACTATTTTGTTGG - Intronic
1178406989 21:32332861-32332883 CTTGTGGGTGAATGGGTTGTGGG - Intronic
1180249344 21:46570534-46570556 CTTGTGGGTTATTTGTATTTTGG + Intergenic
1180259119 21:46655261-46655283 CATGAGGGTTATTGGTCTGTAGG - Intronic
1180666474 22:17516897-17516919 CTGGTTGTTTATTGTTTTTTCGG + Intronic
1181711074 22:24689625-24689647 CTTGAGGGTCTCTGTTTTGTAGG + Intergenic
1182834314 22:33329418-33329440 TTTGTGGGTTTTTTTTTTGTGGG + Intronic
1184621216 22:45679605-45679627 CGTGTGGGTTTTTGTTTTTTGGG - Intronic
949423634 3:3892165-3892187 CTTTTAGGGTATTTTTTTGTTGG + Intronic
951432255 3:22621952-22621974 CTCCTGGGTTATTCTGTTGTAGG - Intergenic
952027122 3:29097056-29097078 CTTATTGGTTATTGTTTTATAGG + Intergenic
952653575 3:35756532-35756554 CTGGTGGGTGATAGTTTTGATGG + Intronic
953382376 3:42482011-42482033 TTGGTGTGTTATTGTTTTATAGG - Intergenic
954576507 3:51679231-51679253 CCTCAGGGTTTTTGTTTTGTGGG + Intronic
956951153 3:74284606-74284628 ATTGTGTTTTATTGTTTTATTGG - Intronic
957281646 3:78157541-78157563 TTGTTGTGTTATTGTTTTGTAGG - Intergenic
957421232 3:79974434-79974456 GTTGTGTGTTATTTTTTTCTGGG + Intergenic
957762689 3:84579201-84579223 CTTGTTTGTTATTGAGTTGTAGG + Intergenic
958271979 3:91511922-91511944 CCTTTGTGTAATTGTTTTGTCGG - Intergenic
959105063 3:102056435-102056457 ATAGTGGGTTGTTGTTTAGTGGG - Intergenic
959654281 3:108783448-108783470 ATTATGGGTTATTGATTTGTAGG + Intergenic
960723169 3:120644443-120644465 CTTTTGGGTTACTGTTTTCTAGG - Exonic
960872937 3:122268272-122268294 CTTGAGTATTATTCTTTTGTAGG + Intronic
961162807 3:124743928-124743950 CTTGTGGGCTATTGTACTGTTGG - Exonic
961188325 3:124935354-124935376 CTTGTGGGTGACTGGTGTGTTGG + Intronic
961367725 3:126411538-126411560 CTTTTGGGCTTTTTTTTTGTTGG + Intronic
961913317 3:130344296-130344318 GTTGTGGGTTTGTGTTTTGGGGG - Intergenic
962192067 3:133321091-133321113 TTTTTGTGTTATTGTTTTATGGG - Intronic
963357223 3:144224057-144224079 CTAATGGGTTATAGTTTTGTGGG - Intergenic
965420357 3:168450195-168450217 CATGTGAGTCATTGTTTTGCTGG + Intergenic
966001894 3:174959352-174959374 CTTGGAGATTATTATTTTGTTGG + Intronic
967783534 3:193465622-193465644 CTAGTACGTTATTGTTTTGCTGG - Intronic
967958517 3:194899248-194899270 CTATTGTGTTATTGTTTTATAGG + Intergenic
971275142 4:25189165-25189187 TTTGTGGGTTTTTGTTTTTTGGG + Intronic
974788115 4:66648678-66648700 TTTGTGAGATATTGTTTTCTAGG - Intergenic
974999838 4:69209223-69209245 CTTTTGGGTTTTTGTTTAGGTGG + Intronic
975235325 4:71989007-71989029 GTTCTGGGTTATTGTTGGGTAGG + Intergenic
975490241 4:74980308-74980330 CTTGTGTGTTATTGGTGTATAGG - Intronic
977791701 4:101112580-101112602 ATTTTGAGTTACTGTTTTGTTGG - Intronic
978164362 4:105589074-105589096 CTTCTTGCTTATAGTTTTGTAGG + Intronic
978440622 4:108729901-108729923 CCTGTGGGTTATTGGTTACTGGG + Intergenic
978561405 4:110037590-110037612 CTTGAGTCTCATTGTTTTGTAGG + Intergenic
978975821 4:114870552-114870574 TTTCTGGGTTTTTGTTTGGTTGG - Intronic
980387348 4:132103362-132103384 CTTGTTGGGTATTCTCTTGTTGG - Intergenic
980519141 4:133908518-133908540 CCATTGTGTTATTGTTTTGTAGG + Intergenic
981829419 4:148983152-148983174 CTTGTGGGTTCATAATTTGTTGG + Intergenic
982266057 4:153539193-153539215 CTGCTGGGTGTTTGTTTTGTTGG - Intronic
982451227 4:155554175-155554197 ATTTTGTGTTATTGTTTTGTAGG - Intergenic
982585251 4:157228842-157228864 CTTTTGGGTTTTTTTTTGGTGGG - Intronic
982771291 4:159399768-159399790 ATGGTGGGTTGTTTTTTTGTTGG - Intergenic
983773795 4:171581931-171581953 CTTCTTGGATCTTGTTTTGTTGG - Intergenic
984071282 4:175116388-175116410 CTTGTAGGTTATTGATGTATAGG - Intergenic
985580024 5:691575-691597 GTTGGGGGCTATTGTTTTGATGG - Intronic
985580061 5:691702-691724 GTTGGGGGCTATTGTTTTGATGG - Intronic
985594871 5:783634-783656 GTTGGGGGCTATTGTTTTGATGG - Intergenic
986191892 5:5504457-5504479 TTTGTGGGTTTTTTTTTTTTTGG - Intergenic
987198713 5:15553104-15553126 TTTGGGGGTTTTTGTTTGGTTGG - Intronic
987960794 5:24805663-24805685 CTTCTGGCTTTTTGTTTAGTTGG - Intergenic
988015125 5:25546589-25546611 CTGGAGAGTTATTGTTTAGTGGG - Intergenic
989522075 5:42414111-42414133 TTTGTCTGTTATTGTTGTGTAGG + Intergenic
989608582 5:43269921-43269943 TGTGTGTGTTATTGTTTTATAGG + Intronic
991529005 5:67594879-67594901 CTTGTGTGTTATTATTCTGATGG - Intergenic
991999163 5:72418257-72418279 CTTGTGGTTTAGAGTTTTCTGGG - Intergenic
992421988 5:76615492-76615514 ATTGTTTTTTATTGTTTTGTTGG + Exonic
992988154 5:82254654-82254676 CTTGCAGGTTATTCTTTTCTAGG + Exonic
993437740 5:87918824-87918846 TTTGTGGGTTTTTTTTTTTTTGG - Intergenic
994200437 5:96968482-96968504 CTTCTGGGTTATTTTTTTCAGGG + Intronic
994777986 5:104059854-104059876 CTATTGTGTTATTGTTTTATAGG + Intergenic
996998312 5:129725985-129726007 CTTGGGGCTTATTTTTTGGTGGG + Intronic
997184548 5:131868537-131868559 CTTGAGGGTTTTTGTTTGGTTGG + Intronic
997850639 5:137329699-137329721 TTTCTGCATTATTGTTTTGTTGG + Intronic
1000192222 5:158922382-158922404 GTGGTCGGTTATTGTTATGTTGG - Intronic
1000626758 5:163547572-163547594 CTTGTTGGTTTTTTGTTTGTTGG + Intergenic
1001524706 5:172420430-172420452 CTTGTGTTTCATTATTTTGTAGG - Intronic
1002448553 5:179306146-179306168 CATGAGGGATATTGGTTTGTAGG - Intronic
1002553304 5:180014526-180014548 CTTCTGCTTGATTGTTTTGTTGG - Intronic
1002648983 5:180677785-180677807 CTTGGGAGTTACTGTTTAGTGGG - Intergenic
1003033376 6:2622083-2622105 CTTGGGAGTTATTGTTTACTGGG - Exonic
1003293684 6:4805052-4805074 TTTCTGGGTTTTTGTTTTTTGGG - Intronic
1004696748 6:18041137-18041159 CTTTTGGGTTTTTTTTTTGGTGG - Intergenic
1005566701 6:27103187-27103209 CATATGTGTTAGTGTTTTGTGGG + Intergenic
1008983129 6:57509215-57509237 CCTTTGTGTAATTGTTTTGTTGG + Intronic
1009171187 6:60402081-60402103 CCTTTGTGTAATTGTTTTGTTGG + Intergenic
1009389527 6:63129256-63129278 CTGTTGTGTTATTGTTTTATAGG + Intergenic
1010241113 6:73616503-73616525 CTTTTGAGTTATTGTTTTACTGG - Intronic
1010541389 6:77096050-77096072 CTTCTGGGATCTTGTTTTGTTGG + Intergenic
1010968690 6:82241351-82241373 AGTGTTGGTTATTGTTGTGTTGG - Intronic
1011715593 6:90102206-90102228 CTTTTGGGTTATGGTCTTGGTGG + Intronic
1011888827 6:92131196-92131218 CTAGTGGGTTATTTTTTCTTAGG - Intergenic
1012800810 6:103825252-103825274 TATGTGGGTTTTTTTTTTGTTGG - Intergenic
1013007858 6:106091058-106091080 CTGATGGGTTATTCTTTTATGGG + Intronic
1013463112 6:110394444-110394466 CCTGGGGGTTATTGTTTATTGGG - Intronic
1013746999 6:113357538-113357560 ATTTTGGGGTATTGTTTTGTGGG + Intergenic
1014102451 6:117527019-117527041 CTTGTGTGTTATTGGATTGAGGG + Intronic
1014299023 6:119657230-119657252 TTTGTGAGTTATGATTTTGTTGG - Intergenic
1014561383 6:122895222-122895244 CTTTTTTGTTATTGTTTGGTTGG + Intergenic
1014580510 6:123131210-123131232 GTTGTGGGTTTTTTTTTTGGGGG - Intergenic
1015082339 6:129242478-129242500 CGTGTGGCTTTTTGTTTTCTTGG + Intronic
1015204709 6:130622834-130622856 CTTTTGGGTTTTTTTTTTGGGGG + Intergenic
1015808406 6:137135804-137135826 CTTCTTGTTTATTGTTTTCTGGG - Intergenic
1015953233 6:138574895-138574917 CTTGTGTGTTCTTCTTTTTTTGG + Intronic
1017138371 6:151167990-151168012 CTTTTTGGTTTTTGTTTGGTTGG + Intergenic
1017671402 6:156772532-156772554 CTTGTGGGTTATGCTTTGGCAGG + Intergenic
1018225846 6:161627954-161627976 CTTGTGGGTATTTGCTTTGTGGG + Intronic
1018440547 6:163808351-163808373 CTTGTGGGTAATTGATTTAAAGG - Intergenic
1018491362 6:164296980-164297002 GTTGTGGGTCATTTTCTTGTGGG - Intergenic
1018492515 6:164308442-164308464 AATGTGGGCTATTGTTTTGAAGG - Intergenic
1018578663 6:165287471-165287493 CTTTTGGCTTAGTGTTGTGTTGG - Intronic
1019530773 7:1502187-1502209 CTTTTGGGTAATTTCTTTGTAGG - Intronic
1019696849 7:2450967-2450989 CTTGTGGGTTTTTTCTTTGGGGG + Intergenic
1020846530 7:13291471-13291493 TTTATGGGTTGTTGTTTTTTTGG + Intergenic
1021122637 7:16814530-16814552 CTTGCGGATTATTTTTCTGTTGG + Intronic
1021130943 7:16912819-16912841 CTGGTGGTTTATTGTATTGTGGG + Intergenic
1021302773 7:18992438-18992460 GCTGTGTATTATTGTTTTGTGGG - Intronic
1021647812 7:22803395-22803417 CTTCTTGGTTCTTGTTTTGCTGG + Intergenic
1023205356 7:37743004-37743026 CTTGTGGGTTTTTGCTTTTTGGG + Intronic
1024014636 7:45301289-45301311 TTTGGGGGTTTTTGTTTGGTTGG - Intergenic
1024398041 7:48891231-48891253 CTTCTGGGATCTTGTTTTGATGG + Intergenic
1025141858 7:56473455-56473477 TTTGTGGGATATTGTTATCTTGG - Intergenic
1025157533 7:56621799-56621821 CTTCTGGGATCTTGTTTTGCTGG + Intergenic
1025708003 7:63884902-63884924 TTTGTGGGATATTGTTATCTTGG - Intergenic
1025758216 7:64366148-64366170 CTTCTGGGATCTTGTTTTGCTGG - Intergenic
1027630679 7:80601034-80601056 CTTGTGGGTCAAAATTTTGTGGG + Intronic
1030083429 7:105797353-105797375 CTTGTGTGGTCATGTTTTGTTGG - Intronic
1030151356 7:106408670-106408692 TGTGTGGGTTTTTGTTTGGTTGG - Intergenic
1030249224 7:107423673-107423695 CTTGAGGGAGATTATTTTGTAGG - Intronic
1030823655 7:114127115-114127137 CTTGTGGGTTATTGGACTGAGGG + Intronic
1030856815 7:114568417-114568439 CTTGTGGGTTTTTTTTTGGGGGG + Intronic
1031247832 7:119339831-119339853 CTTGTCTGTTATTGGTGTGTAGG - Intergenic
1031828343 7:126595201-126595223 TTTGTGGATTTTTGTTTTTTTGG + Intronic
1031895309 7:127340912-127340934 CTTGTTGCTTACTGATTTGTTGG - Intergenic
1035954531 8:4061543-4061565 CATGAGGGTTATTATTCTGTAGG - Intronic
1035967295 8:4206818-4206840 CTTTTGAGTGATTATTTTGTGGG + Intronic
1037444645 8:18953020-18953042 CTGCTGGGTTATTGATGTGTTGG - Intronic
1037738941 8:21589857-21589879 CTTGGGGCTGATTGTTTTGGGGG - Intergenic
1038778805 8:30553696-30553718 CTAATGGGTTAATGTTTTGAAGG - Intronic
1038930654 8:32189888-32189910 CTAGTAGATTATTATTTTGTAGG + Intronic
1040960096 8:53022572-53022594 CTTGTGCATTTTTGTTTGGTTGG - Intergenic
1041750539 8:61256097-61256119 ATTGGGAGTTATTGTTTTATGGG - Intronic
1042001842 8:64132128-64132150 CTTGTTTGTTTTTGTTTTTTTGG - Intergenic
1043411411 8:80000949-80000971 CTTTGGGGATATTCTTTTGTCGG - Intronic
1044531711 8:93315123-93315145 CTTGTAGGGTGTTGTTTTGAAGG - Intergenic
1046283269 8:112061519-112061541 CTTATGGGTTATTGTTCTATAGG - Intergenic
1046435807 8:114188049-114188071 TTTGTGGTTTATTATTTTGTGGG - Intergenic
1047729652 8:127716421-127716443 CTTGTGCGTTATTGGGTTGGTGG - Intergenic
1048567792 8:135621604-135621626 ATAGTGAGTTATTGTTTAGTGGG + Intronic
1048894179 8:138974455-138974477 CTTGTGGGTTGTTGGTCTGAGGG - Intergenic
1049702123 8:144020092-144020114 CTTGTGGGGTAGAGTCTTGTGGG - Intronic
1050250320 9:3736648-3736670 CTTGTTTGTTTTTGTTTTGGAGG + Intergenic
1052711585 9:32063209-32063231 CTTGTGCTTTGTTTTTTTGTTGG - Intergenic
1053181107 9:35971424-35971446 CTTGTGGTTTAGGGTTTTCTGGG + Intergenic
1054844636 9:69780970-69780992 GGTGTGTGTTATTGTTTTATAGG + Intergenic
1056034099 9:82585293-82585315 CTTGGGGGAAATTGTTCTGTGGG - Intergenic
1056034558 9:82590098-82590120 CTTGGGGGAAATTGTTCTGTGGG - Intergenic
1056087774 9:83169543-83169565 CATTTGGGTTTTTGTTTGGTTGG + Intergenic
1056751026 9:89351324-89351346 AATGTGTGTTTTTGTTTTGTTGG + Intronic
1057735390 9:97653977-97653999 CTTGTGGGTTTAAATTTTGTAGG + Intronic
1061789872 9:133053583-133053605 CCTGTGGGTTTTTGTTTTTTGGG - Intronic
1062308469 9:135922551-135922573 TTTGTAGGTTTTTGTTTTTTGGG + Intergenic
1186646570 X:11513287-11513309 CTTGTGGGTTTTTTTGTTGGTGG - Intronic
1187737674 X:22321500-22321522 TTTGTAGGTTACTTTTTTGTAGG + Intergenic
1188932861 X:36135529-36135551 CTTGTGGGGTCTTGTTGTTTTGG - Intronic
1189181065 X:39004928-39004950 CTTCAGGGTCACTGTTTTGTTGG - Intergenic
1189269960 X:39744292-39744314 CTTGTGTGCTAGTGTTTTATGGG + Intergenic
1190177578 X:48164170-48164192 GTTGTGGGTAATTGTTTTGGAGG - Intergenic
1190183612 X:48216165-48216187 GTTGTGGGTAATTATTTTGGGGG - Intronic
1190196693 X:48325861-48325883 GTTGTGGGTAATTGTTTTAGGGG - Intergenic
1190199517 X:48348306-48348328 GTTGTGTGTAATTGTTTTGGGGG + Intronic
1190663421 X:52676232-52676254 GTTGTGGGTAATTGTTTTAGGGG - Intronic
1190666292 X:52698789-52698811 GTTGTGTGTAATTGTTTTGGGGG + Exonic
1190673126 X:52759621-52759643 GTTGTGTGTAATTGTTTTGGGGG - Exonic
1190676002 X:52782250-52782272 GTTGTGGGTAATTGTTTTAGGGG + Intronic
1192019290 X:67367916-67367938 CTTGTCTGTTATTGGTTTATAGG - Intergenic
1192755446 X:74042384-74042406 CTTGTCTGTTATTGGTTTGTAGG + Intergenic
1193105641 X:77668806-77668828 CTTGTTTGTCATTGTGTTGTTGG - Intronic
1193166845 X:78290755-78290777 TTTGTGTGTTATTGTTGTATAGG + Intronic
1193528266 X:82620245-82620267 CTTGTGGCTTATCTTCTTGTGGG - Intergenic
1193645955 X:84068763-84068785 CTTGTGTATTATTGGTGTGTAGG - Intronic
1193849834 X:86523575-86523597 CTTGTAGGTTAGGGTTTTTTTGG + Intronic
1195423158 X:104698047-104698069 CTTGTGGGTTGTTGGACTGTGGG + Intronic
1195649469 X:107270069-107270091 CTTGAGGGTTTTTTTTTTGTGGG - Intergenic
1196514962 X:116599264-116599286 TTTGAGGGTTATTGTTATGAAGG + Intergenic
1197031196 X:121818262-121818284 GTTGTGGGGTTTTTTTTTGTAGG + Intergenic
1199047354 X:143191147-143191169 CCTGTGGTTGATTGTGTTGTTGG + Intergenic
1199798092 X:151222092-151222114 TTTGAGGTTTATTTTTTTGTTGG + Intergenic
1199870343 X:151892786-151892808 CTGGTGGGTAATTTTATTGTTGG + Intergenic
1200839246 Y:7763520-7763542 TTTGTCTGTTATTGGTTTGTAGG - Intergenic
1200852224 Y:7895081-7895103 CTTCTGGGTTTTTGTTTGGCTGG + Intergenic
1200898369 Y:8400932-8400954 CTTCTGGGATCTTGTTTTGCTGG + Intergenic
1201052612 Y:9953412-9953434 CTTTTGGCTCATGGTTTTGTAGG + Intergenic
1201580855 Y:15510871-15510893 CTTGTGGTTTTTTTTTTTGGGGG - Intergenic
1202188183 Y:22211247-22211269 CTTTTGGCTCATGGTTTTGTAGG + Intergenic