ID: 924068122

View in Genome Browser
Species Human (GRCh38)
Location 1:240247139-240247161
Sequence TTGTTCCTATGTAAAATCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 316}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924068118_924068122 19 Left 924068118 1:240247097-240247119 CCTCTTCTGAATGTCTGCCTTCT 0: 1
1: 0
2: 0
3: 31
4: 407
Right 924068122 1:240247139-240247161 TTGTTCCTATGTAAAATCTTAGG 0: 1
1: 0
2: 1
3: 18
4: 316
924068121_924068122 2 Left 924068121 1:240247114-240247136 CCTTCTGAAAGGTGGTAGATGAT 0: 1
1: 0
2: 1
3: 14
4: 150
Right 924068122 1:240247139-240247161 TTGTTCCTATGTAAAATCTTAGG 0: 1
1: 0
2: 1
3: 18
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924068122 Original CRISPR TTGTTCCTATGTAAAATCTT AGG Intronic
901364565 1:8735195-8735217 TTGTTACAATCTAAAATCTAAGG + Intronic
903614948 1:24644603-24644625 TTGTTCTTAGGTAAAATACTTGG - Intronic
903973498 1:27134352-27134374 TGGTTATTATGTAAAATCGTGGG - Intronic
905705125 1:40050396-40050418 TTTTTCCTTTGAAATATCTTGGG + Intronic
905984505 1:42266774-42266796 TTTTTGCTTTGTAAAATCTATGG - Intronic
906180485 1:43814115-43814137 TTTTAGCTATGGAAAATCTTGGG + Intronic
906996480 1:50800296-50800318 TTTTTGCTATGCAAAATCTGTGG - Intronic
908783953 1:67716860-67716882 ATATTCCTATGTAGAATCTGGGG - Intronic
908908475 1:69043706-69043728 ATGTACATGTGTAAAATCTTAGG - Intergenic
909093948 1:71263694-71263716 TCTTCCCCATGTAAAATCTTAGG - Intergenic
909275360 1:73678206-73678228 TTGTTCCTAAGGAACATCATAGG + Intergenic
909836807 1:80265490-80265512 CTGTTCCTGTGTTAATTCTTAGG - Intergenic
911202479 1:95059549-95059571 TTGTTTCTATGTTAACTTTTGGG + Intronic
913615605 1:120557408-120557430 TGGTTCCTCTGTGGAATCTTTGG - Intergenic
913646625 1:120861729-120861751 CTGCTCCTATGACAAATCTTTGG - Intergenic
914080023 1:144401143-144401165 CTGCTCCTATGACAAATCTTTGG + Intergenic
914174929 1:145269678-145269700 CTGCTCCTATGACAAATCTTTGG + Intergenic
914529654 1:148511157-148511179 CTGCTCCTATGACAAATCTTTGG + Intergenic
914574671 1:148953494-148953516 TGGTTCCTCTGTGGAATCTTTGG + Intronic
915628210 1:157130375-157130397 TTTTTTCTAAGCAAAATCTTAGG - Intronic
916208970 1:162343103-162343125 CTGCTCCTATGTAGAGTCTTAGG - Intronic
916287325 1:163122690-163122712 CTGTTTCTAGGTACAATCTTAGG + Intronic
916449890 1:164910554-164910576 TTGTCACTATATAATATCTTTGG - Intergenic
917447201 1:175116551-175116573 TTCTTCATCTGTAAAATCTGAGG - Intronic
918547513 1:185701390-185701412 ATCAACCTATGTAAAATCTTGGG - Intergenic
918862171 1:189843873-189843895 TTGTTCCTCTTTTAAATGTTTGG + Intergenic
918978145 1:191517677-191517699 ATGCTCCTATGTAAAATATCTGG - Intergenic
919162025 1:193842159-193842181 TTGATAGTATGTAAAATATTTGG - Intergenic
919363529 1:196626382-196626404 TTGTACTTATGTGAAATCGTGGG - Intergenic
920731523 1:208489717-208489739 TTGTTCCTATTCATCATCTTTGG - Intergenic
921098285 1:211905898-211905920 TTGTGCCTATTCAAAACCTTTGG - Intergenic
922284723 1:224160068-224160090 TTGTTCAAATCTTAAATCTTAGG + Exonic
924068122 1:240247139-240247161 TTGTTCCTATGTAAAATCTTAGG + Intronic
924529506 1:244881477-244881499 TAGTTACATTGTAAAATCTTTGG - Intergenic
924950727 1:248880613-248880635 TTGTCCATATGTGAAGTCTTGGG + Intergenic
1063056919 10:2515185-2515207 TTATTTCTATATTAAATCTTTGG - Intergenic
1063705515 10:8426673-8426695 TTTTTCCTCTGGAAACTCTTAGG - Intergenic
1064382616 10:14860175-14860197 TTGTCACTTTGTAAACTCTTTGG + Intronic
1064811616 10:19206249-19206271 TTTTGCCTATGTGTAATCTTTGG + Intronic
1065733907 10:28734113-28734135 CTGTTCCTATGTAAATTCCTGGG + Intergenic
1065818510 10:29504240-29504262 TTCTTCCTATGTAATATTCTAGG - Intronic
1065844209 10:29731600-29731622 TTTTCCATATGTAAAACCTTAGG - Intronic
1066593108 10:37017266-37017288 CTATTCCTATAAAAAATCTTGGG - Intergenic
1069262746 10:66419306-66419328 TTATTCCTATGTAATTTTTTTGG - Intronic
1071526143 10:86360255-86360277 TTTTTCCTATTTAACATCATTGG - Intronic
1072283659 10:93893576-93893598 ATGGTGCTTTGTAAAATCTTCGG + Intergenic
1072970284 10:100011123-100011145 TTGTACGTATATAACATCTTTGG + Intergenic
1073020526 10:100439814-100439836 TTTTTCTTATATGAAATCTTGGG - Intergenic
1073314094 10:102566311-102566333 TTGTTTCTATGTATAATGCTAGG - Intronic
1073758402 10:106605531-106605553 ATGTTCCTATCTAAAGGCTTTGG + Intronic
1075869036 10:125754852-125754874 TTTTACCGATGTATAATCTTAGG + Intronic
1076125493 10:127970789-127970811 TTGTTACTATGGAAGATTTTAGG + Intronic
1078749237 11:14144050-14144072 TTTTTCAAATGTAAAATCTAAGG - Intronic
1079406358 11:20150196-20150218 TTGGTCATATGGAAAATATTGGG - Intergenic
1080183340 11:29449703-29449725 TTGTTCTTATTTTAAATCTGAGG + Intergenic
1080219406 11:29882946-29882968 TTGTCCTTATGTAAAATGATAGG + Intergenic
1080304375 11:30820628-30820650 TTGTATCTATGTTAAATATTGGG + Intergenic
1080382112 11:31782735-31782757 TTGTTTCTATGCATAATGTTGGG - Intronic
1085825752 11:79845414-79845436 TTGTTCCTATTAACATTCTTGGG + Intergenic
1086136824 11:83450177-83450199 TTGTTACAATGCAGAATCTTAGG - Intergenic
1086414072 11:86571304-86571326 TTGGTCCTATTTTAAATCTTGGG + Intronic
1087072264 11:94092856-94092878 TTGTTCCTAGGGAAAATATAGGG - Intronic
1087766373 11:102159572-102159594 TTTTTCCTATTTTAAATATTGGG + Intronic
1088643833 11:111899471-111899493 TTACTGCTATGTAAAATATTAGG + Intergenic
1088694283 11:112353572-112353594 TTGTTCCTTTGGTAAATCTAGGG + Intergenic
1088909042 11:114176814-114176836 TTGGTACTTTGGAAAATCTTGGG + Intronic
1089523449 11:119081093-119081115 TTGGTCTTTTGGAAAATCTTAGG - Exonic
1092506777 12:9109811-9109833 TTCTTCATATTTAAACTCTTAGG - Intronic
1092714391 12:11373620-11373642 TTCTTCCTATTTAAATTTTTAGG + Intronic
1092718102 12:11412650-11412672 TTGTTCCTATTTAAATTTTTAGG + Intronic
1094243581 12:28259478-28259500 TTTTTCCCATGTAACATTTTTGG + Intronic
1094266268 12:28564050-28564072 TTGTTTCTATGAATAATCTGTGG - Intronic
1094720436 12:33057762-33057784 TTCTTCCTCTTTAAAATATTAGG + Intergenic
1097354324 12:58584623-58584645 TTGCTGCTATGTAAATTCATAGG - Intronic
1098213413 12:68190051-68190073 CTGTTCATCTGTAACATCTTGGG - Intergenic
1098729050 12:74009812-74009834 TTGATCCTAGATAAATTCTTAGG + Intergenic
1099044617 12:77700429-77700451 TTGTTTTTATGGAAAATTTTAGG - Intergenic
1099095862 12:78373504-78373526 GTGTTCATATGTAAAATATGTGG - Intergenic
1099331527 12:81295030-81295052 TTTTTCCTATCTAACAGCTTTGG - Exonic
1100626617 12:96340432-96340454 TTGTTCCTATTTTTAATCTGTGG + Intronic
1100659669 12:96683204-96683226 TTGTTGGTATGTAAATGCTTAGG + Intronic
1100785657 12:98075322-98075344 TTTTTCCTAGGTAAAATTTCTGG - Intergenic
1101417006 12:104517167-104517189 TTTTTTGTCTGTAAAATCTTGGG + Intronic
1101625197 12:106433709-106433731 TTTTGCCTAGGTAACATCTTAGG + Exonic
1102322297 12:111947054-111947076 TTGATTAAATGTAAAATCTTTGG - Intronic
1104253751 12:127122013-127122035 TTTTTCTTATGAAAAATATTTGG - Intergenic
1105015639 12:132785268-132785290 TGGTTGCTTTGTAAAATGTTGGG - Intronic
1105052268 12:133065195-133065217 TTGTTCTTATTTACTATCTTGGG + Intergenic
1105642643 13:22281279-22281301 TTATTCCTTTGTAATATCTGGGG - Intergenic
1105770229 13:23603502-23603524 TAGTTTCTTTGTAAAGTCTTTGG - Intronic
1106319296 13:28623478-28623500 TTCTTTTTATGTAAATTCTTTGG + Intergenic
1106683248 13:32030069-32030091 TTGTTTCAAGGTAAAACCTTTGG + Intergenic
1107009699 13:35656310-35656332 TTCTTCCTATGGGATATCTTAGG - Intronic
1107864523 13:44690801-44690823 TTGGTCATATGTAAACTTTTAGG - Intergenic
1109032049 13:57204027-57204049 TTGTTTATATGTAAAGTTTTTGG - Intergenic
1109297730 13:60555048-60555070 TTGTTCTTGTAGAAAATCTTGGG + Intronic
1109408938 13:61939494-61939516 TTGGTACTATGTTCAATCTTTGG - Intergenic
1110483342 13:76009472-76009494 TTGTGCCTCTTTAAACTCTTTGG + Intergenic
1111103884 13:83621452-83621474 TTTTTACTATGCAAAAACTTTGG - Intergenic
1111405453 13:87798572-87798594 TTGTTTGTTTGTAAAATCATGGG + Intergenic
1112070861 13:95848563-95848585 TTGTTCCTCTGTCAAAGATTGGG + Intronic
1112697387 13:101965866-101965888 TTGTGCCCATGAAAAATGTTTGG - Intronic
1112937051 13:104813997-104814019 TTGTTCTAATGTAGAATCGTTGG + Intergenic
1114273689 14:21122014-21122036 AAGTTTCTATGTAAACTCTTTGG + Intergenic
1114377430 14:22163232-22163254 TTGTTCATATGTAAAATGAAGGG + Intergenic
1116157955 14:41232392-41232414 TTTTTCCATTGTAACATCTTAGG - Intergenic
1116244895 14:42397221-42397243 TTGTCCCTATCTAAAAGCTTAGG - Intergenic
1117061604 14:51969652-51969674 TTTTTCCTATATAAGATCTGTGG + Exonic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1120632620 14:86909528-86909550 TTGTTCCCAGGTAAAATCAGTGG - Intronic
1121159045 14:91717702-91717724 TTGAGTGTATGTAAAATCTTGGG - Intronic
1123027542 14:105434164-105434186 TAGTCCCTATGTAATATCCTTGG + Intronic
1123847860 15:24322493-24322515 TTGTTCTAAGGTAAAATCGTAGG - Intergenic
1124909270 15:33902660-33902682 TTGTTACTATGTGGAATCTTTGG - Intronic
1125986151 15:44054670-44054692 TTAATCATATGTAAACTCTTTGG + Intronic
1131013242 15:89036393-89036415 TACTTCATTTGTAAAATCTTTGG + Intergenic
1132377162 15:101336631-101336653 TTGTTCCTAGCAAATATCTTTGG - Intronic
1135190079 16:20347773-20347795 TTGTACCTATGAGAAATCTGAGG + Intronic
1136999110 16:35213637-35213659 TTTTTCTTATGTAATTTCTTTGG - Intergenic
1137017254 16:35390325-35390347 TTTTTCTTATGTAATTTCTTTGG - Intergenic
1137376897 16:47959553-47959575 TTGTTTCTATGCAAAATCCGAGG - Intergenic
1137438667 16:48479900-48479922 CTGTTCCAATGTAAAATCCAGGG + Intergenic
1138958342 16:61999223-61999245 TTTTTCATCTGTAAAATATTTGG - Intronic
1139050119 16:63114203-63114225 CTCTTCCTGAGTAAAATCTTTGG - Intergenic
1139424367 16:66870079-66870101 TTTTTCCTTTGCAAAATCATTGG - Intronic
1140178236 16:72687181-72687203 TTGTTCCTCTGTATAATTTTTGG + Intergenic
1142606234 17:1082717-1082739 TTGTTCAAATATAGAATCTTGGG + Intronic
1145291563 17:21550854-21550876 TTTTTCCTATTTAAAATAATGGG + Intronic
1146227350 17:31078443-31078465 ATGTTCCTGTGTCACATCTTTGG + Intergenic
1146701663 17:34966270-34966292 TTGTTACTATTAAAGATCTTAGG - Intronic
1146947197 17:36881965-36881987 TTGTGCCTATTAAAAATCTTAGG + Intergenic
1148880607 17:50723345-50723367 ATGTTCTTTTCTAAAATCTTTGG + Intronic
1149875927 17:60233016-60233038 TTGTTCATATGTGAAAACTGAGG + Intronic
1150192151 17:63254364-63254386 CTGTTTTTTTGTAAAATCTTTGG + Intronic
1151129892 17:71885969-71885991 TTGTTTCTACTTAAAACCTTGGG - Intergenic
1151131971 17:71906748-71906770 ATGTTCCTATGTAAATATTTGGG - Intergenic
1153572242 18:6485104-6485126 GGGTTCCTATGTAGCATCTTAGG + Intergenic
1155895340 18:31318037-31318059 TTGCTCCCAGGTAAAAACTTGGG - Intergenic
1156557979 18:38089022-38089044 TTAATCCTATGTTAAATCTATGG + Intergenic
1157605992 18:48926291-48926313 TTGTTCCTAAATGGAATCTTGGG - Intronic
1157612265 18:48964569-48964591 TTCCTCCTAAATAAAATCTTTGG + Intergenic
1158494987 18:57946947-57946969 TTGCTTCTTTGTAAAACCTTAGG + Intergenic
1159534378 18:69696682-69696704 ATATTCCTGTGTAAAACCTTTGG + Intronic
1159611898 18:70535083-70535105 TTGTTCCTATGTTATATTTAAGG + Intergenic
1160123082 18:76147684-76147706 TTGGTCCTCTCTAAAACCTTAGG + Intergenic
1160195121 18:76747523-76747545 TTGATAAAATGTAAAATCTTTGG + Intergenic
1163891914 19:20024177-20024199 TTCTTCCTCTGTAGAATGTTTGG - Intronic
1164687909 19:30181415-30181437 TTATACCTATGTAAAATATATGG + Intergenic
1165659430 19:37562985-37563007 TTTTTCCTATTTAAAATAATGGG + Exonic
1166028901 19:40110572-40110594 TTGATAAAATGTAAAATCTTTGG + Intergenic
924990716 2:310487-310509 TTTTTCCTAGGTATAATATTAGG - Intergenic
926820057 2:16842144-16842166 TTCTTCCTAGGCAAAATATTAGG - Intergenic
927348897 2:22082808-22082830 TTCTTCCTATCCAAAATATTGGG - Intergenic
929303495 2:40332917-40332939 CTTTTCCTATGAAAAACCTTAGG - Intronic
929422568 2:41808213-41808235 TCTTTCCTTTGTAAAATATTTGG - Intergenic
930590104 2:53316836-53316858 TTTTTCCTATGCCAAATGTTTGG - Intergenic
931669542 2:64634775-64634797 TTGTTCGGATGTAAAATTTCAGG + Exonic
931941523 2:67256970-67256992 TTCTTCATCTGTAAAATGTTGGG + Intergenic
932696955 2:73964880-73964902 TTCTTCCAGTGTAAAAGCTTGGG - Intergenic
933164735 2:79063753-79063775 TTGTTAGAATGCAAAATCTTAGG + Intergenic
933445101 2:82369777-82369799 TCGTTGCTATGTAAATTCATTGG - Intergenic
933826541 2:86166741-86166763 TTGTTCCTTTTTAAATTTTTTGG - Intronic
935077540 2:99760367-99760389 CTGTTTCTATGAAAAAACTTAGG - Intronic
936686411 2:114831982-114832004 TTGTTCTTAATTAAAATATTGGG - Intronic
936995228 2:118407131-118407153 TTGTTTGGATATAAAATCTTCGG + Intergenic
937375606 2:121333821-121333843 TTCTTCCTCTGTAAAATCCTAGG - Intergenic
938040427 2:128071109-128071131 TTAGGCCTATGTTAAATCTTCGG + Intergenic
938656499 2:133439987-133440009 TTGTTTCTATGTTAAACATTAGG + Intronic
939158613 2:138557480-138557502 ATGGTCCAATGTAAAATGTTTGG - Intronic
939726326 2:145725819-145725841 TTGTGTTTATATAAAATCTTAGG + Intergenic
940086867 2:149869525-149869547 TTGTGCCAATGTCAAATCTTTGG + Intergenic
941192103 2:162397563-162397585 TTGCTCTTCTGTAAAATCTAGGG + Intronic
941201322 2:162514102-162514124 CTGTGCCCATTTAAAATCTTGGG + Intronic
942587113 2:177493017-177493039 TTTTTCCTCTGTAAATCCTTAGG + Intronic
943316373 2:186393613-186393635 TTGTTCTAGTGTAAAATTTTTGG - Intergenic
944335880 2:198533743-198533765 TTGTTTTTATATAAAATCATAGG + Intronic
944500898 2:200359046-200359068 TTACTCCTATTTAAAAGCTTGGG - Intronic
944909138 2:204292168-204292190 TTGTCCCTATGTAAGATTTATGG - Intergenic
944941168 2:204629115-204629137 TTGTTCCCCTGTGAAAGCTTTGG - Intronic
945371818 2:209027939-209027961 TTGTTCCTATGGAAAATACAAGG + Intergenic
945681482 2:212919127-212919149 CTGTCCCACTGTAAAATCTTTGG + Intergenic
945747919 2:213741663-213741685 TTATTGCAGTGTAAAATCTTAGG + Intronic
945968514 2:216213517-216213539 TTGATAAAATGTAAAATCTTTGG + Intergenic
946059541 2:216929913-216929935 ATGGTCATATGTAAAAACTTAGG - Intergenic
946671453 2:222109330-222109352 ATGTTTCTCTGTAAACTCTTTGG - Intergenic
946799947 2:223403800-223403822 TTGTGCATGTGTAAAATCATTGG + Intergenic
947090832 2:226509786-226509808 TTTTTCCTATGTAAAAGTCTTGG + Intergenic
1169005397 20:2202924-2202946 TTGTTCCTAAGAAAATTCATAGG + Intergenic
1170137841 20:13094718-13094740 TTGTTCAAATGAAAAATCTATGG + Intronic
1170301372 20:14887942-14887964 TTCTTCCTATGTGCAATTTTTGG - Intronic
1170388502 20:15846974-15846996 TAGTTCCTAAGTTACATCTTTGG - Intronic
1171319681 20:24231317-24231339 TTGATCATCTGTATAATCTTTGG - Intergenic
1172600879 20:36182162-36182184 TTTCTCCTATGTATAATCTCAGG - Intronic
1172761513 20:37326575-37326597 TTCCTCTTTTGTAAAATCTTAGG - Intergenic
1173835789 20:46124470-46124492 TTGTTTATATGTAGAATCTCTGG - Intronic
1174965088 20:55204099-55204121 TTGTTCCTATTTTAATTTTTTGG + Intergenic
1175009686 20:55722583-55722605 TTATTAATAAGTAAAATCTTTGG + Intergenic
1176925280 21:14741552-14741574 TTCTTCCTAATTAAAATCTCTGG + Intergenic
1177104285 21:16935259-16935281 TTGTTAATATGTAAAAACCTTGG - Intergenic
1177812987 21:25944775-25944797 TTGTTCCAGTCTAAAATCATTGG + Intronic
1177967267 21:27743924-27743946 CATTTCCTATGAAAAATCTTTGG + Intergenic
1178019063 21:28388626-28388648 GTGTTCATCTGTGAAATCTTTGG + Intergenic
1180725315 22:17942519-17942541 ATGATCATATGTAAAATCTAAGG + Intronic
1181887885 22:26036049-26036071 TGCTTCCTATGTACAATCTTTGG - Intergenic
1182957262 22:34438266-34438288 TTGTGTCAGTGTAAAATCTTAGG - Intergenic
949766128 3:7528481-7528503 TTGATCCTATGTATGATTTTTGG + Intronic
951395375 3:22159004-22159026 TGTTTCCTATCTATAATCTTAGG - Intronic
951978095 3:28536970-28536992 TTATTTCTTTGTTAAATCTTTGG - Intronic
952652429 3:35742291-35742313 TTGTTCCTATTTTTAATATTGGG + Intronic
952686546 3:36156016-36156038 TTATTCATATGTTAAATCTTTGG - Intergenic
955530577 3:59868866-59868888 TTGTTCATATATAAAATCCCAGG + Intronic
957199600 3:77115578-77115600 TTTTTACTATGTAAAATGTGAGG - Intronic
957282053 3:78164159-78164181 TTGTTTCTTTGTTAATTCTTAGG - Intergenic
957467411 3:80611866-80611888 TATTTCCTATTCAAAATCTTTGG - Intergenic
958132333 3:89443857-89443879 TTGGTCAAATGTAAACTCTTTGG - Intronic
958788646 3:98626157-98626179 TAGTTGCTATGTAACATTTTAGG + Intergenic
959011135 3:101077688-101077710 TTCTTCATATTTACAATCTTAGG - Intergenic
959095125 3:101947425-101947447 TTTTTGCTATGTACACTCTTAGG - Intergenic
960748306 3:120915304-120915326 ATGTTCCTGTGAAAAATCTCAGG + Intronic
962434555 3:135353421-135353443 TTGTTCATCTGGAAAATCTCAGG + Intergenic
962522644 3:136211377-136211399 TTGTCCCTATGTTATGTCTTGGG + Intergenic
963647735 3:147937577-147937599 TTGTTCCTCTGTAATTCCTTAGG + Intergenic
964165465 3:153699646-153699668 TTCTTTCTAAATAAAATCTTAGG + Intergenic
964539312 3:157761658-157761680 GTGTTCCTTTATAAAAGCTTGGG - Intergenic
964780984 3:160337642-160337664 ATAGTTCTATGTAAAATCTTCGG + Intronic
965957848 3:174392324-174392346 TTTTTCGTATGCAAAATTTTTGG + Intergenic
967927060 3:194658855-194658877 TTATTCTTATGGAAAATCTGTGG - Intronic
968168411 3:196488085-196488107 TTCTTCATATGTAAATGCTTAGG + Intronic
969549556 4:7855667-7855689 TCTTTCCTTTGTAAAGTCTTCGG + Intronic
970440702 4:16078905-16078927 TTCTTCCTTTGTCAAATCATGGG + Intronic
971098156 4:23432035-23432057 TTGTCCATATGTTAAATATTAGG + Intergenic
971493228 4:27236627-27236649 TAGTTCTTATGTGAGATCTTTGG + Intergenic
971680415 4:29691875-29691897 TTATTCCTGGATAAAATCTTGGG - Intergenic
972230844 4:37071108-37071130 TTCTACCTATTTAAAATATTTGG + Intergenic
972706011 4:41543633-41543655 TTGTTACTATCTTAATTCTTTGG + Intronic
973895507 4:55408647-55408669 CTGTTCCTCTGTAAAATGTAGGG - Intronic
974811315 4:66949811-66949833 TTCTTCTTCTGAAAAATCTTGGG - Intergenic
974835813 4:67249412-67249434 TTGTTCATATGAACTATCTTGGG - Intergenic
977477695 4:97534073-97534095 TTGTTACTTTTTAAAATTTTAGG + Intronic
979089287 4:116459636-116459658 TTGTGCCTATGTAATTTTTTTGG + Intergenic
979320808 4:119323172-119323194 TTGACCCTAAGTAATATCTTGGG - Intergenic
980518113 4:133891718-133891740 ATGTTCCTATACAAAATATTAGG + Intergenic
981355431 4:143784468-143784490 TTGTTCCTATATATGATCATAGG - Intergenic
981658501 4:147139310-147139332 TTGTGTCTATGTCACATCTTAGG + Intergenic
982434114 4:155362609-155362631 CTTTTCCTATCTAAAATATTTGG - Intronic
982986773 4:162218999-162219021 TTTTTCCCCTGTAAAAACTTTGG - Intergenic
983655800 4:170082806-170082828 TTGTTTCTTTTTACAATCTTAGG - Intronic
984644762 4:182207690-182207712 TTCTTAATATGTAAAAGCTTGGG + Intronic
984794008 4:183641957-183641979 TTTTTTCTAAGAAAAATCTTTGG + Intronic
985519291 5:363881-363903 TTGTTCCCATGTGAAATTCTGGG - Intronic
985834767 5:2262229-2262251 GTGTTCCTATGGAAACTATTTGG + Intergenic
986602243 5:9484110-9484132 TTTTTCCTCTGAAAAATCTGTGG - Intronic
987627184 5:20417624-20417646 TTGGTCCTATGAAAAAACTCTGG + Intronic
988152536 5:27404331-27404353 TTTTTACTATGTATTATCTTTGG + Intergenic
989977496 5:50603418-50603440 CTGCTCCTATGACAAATCTTTGG - Intergenic
992959503 5:81944828-81944850 TTTTGCCTATTTAAAATATTGGG + Intergenic
993562378 5:89426356-89426378 TTGTTTCTATATAATATTTTAGG + Intergenic
994133193 5:96254974-96254996 TTAATCCTACTTAAAATCTTTGG + Intergenic
994289755 5:98014762-98014784 TTTTTTCTAAGTAAAGTCTTTGG - Intergenic
995424598 5:112006087-112006109 CTCTTCCATTGTAAAATCTTAGG - Intergenic
995999114 5:118337016-118337038 TTGTTTCTATGTGAATTTTTAGG - Intergenic
998881585 5:146650757-146650779 CTTTTCCTATGGAAGATCTTTGG - Intronic
1000080442 5:157840420-157840442 TTGTTTCAATGTCAAATTTTCGG + Intronic
1000146475 5:158458045-158458067 TTGTTCCTAGGTACACACTTTGG + Intergenic
1000174597 5:158738917-158738939 TTGTTCATGTGTAAAATGTCAGG - Intronic
1000457001 5:161462002-161462024 TTGTTCCCATGAAAACTGTTCGG - Intronic
1001736175 5:174004729-174004751 TCGTTGCTATGTAAATTCTAAGG - Exonic
1002111375 5:176916233-176916255 TTGTTCCTTTTTGAAATCTGTGG - Intronic
1003449922 6:6221180-6221202 TTCTTCCTACTTAAACTCTTAGG + Intronic
1003781030 6:9427067-9427089 TTGTACCAATGTAATATTTTTGG - Intergenic
1003990871 6:11485186-11485208 TTGTTCCAACGTAAAAGCCTTGG + Intergenic
1004886417 6:20055395-20055417 TTGTGTTTATGTATAATCTTAGG - Intergenic
1005395790 6:25380670-25380692 TTCTTCCTTTTTAAAATCTAAGG + Intronic
1005773649 6:29104438-29104460 TTGTTCCTATGTTAAAGATTAGG + Intergenic
1007211511 6:40196496-40196518 TTTTTCCTCTTTAAAATATTAGG - Intergenic
1009313882 6:62193230-62193252 TTGTTCCTCTGTTAAATTTAAGG + Intronic
1009352048 6:62692705-62692727 TTATTCCTAGGTAAATTTTTTGG - Intergenic
1009555014 6:65151771-65151793 TTTTTCTTATTTAAAATATTTGG + Intronic
1010157775 6:72814617-72814639 TTGTTTCTGTGTCAAATCCTTGG + Intronic
1010954915 6:82079038-82079060 TACTTACTATTTAAAATCTTTGG - Intergenic
1012029798 6:94043978-94044000 TTGTTTATTTATAAAATCTTTGG + Intergenic
1013171931 6:107644382-107644404 TTGTTCCTCTGAAATGTCTTAGG + Intronic
1013759367 6:113498922-113498944 TTTCTCCTATGTAAACTCCTGGG - Intergenic
1014664953 6:124226158-124226180 TTTTTCCTATGTAAGCTGTTAGG + Intronic
1015826451 6:137317505-137317527 TTCTCTCTATGTAAAATGTTGGG - Intergenic
1016980704 6:149851531-149851553 TTTATCCTGTGTAAAAGCTTTGG - Intronic
1017609747 6:156172892-156172914 TTATTGCTATGTAAAATATTTGG - Intergenic
1017920233 6:158865370-158865392 TTATTCCTATGTACATGCTTGGG + Intergenic
1018802092 6:167231315-167231337 TTTTTCCTTTTTAAAATTTTTGG + Intergenic
1020992721 7:15220558-15220580 TTGTTCCTATTTAAAGTGCTTGG + Intronic
1021384755 7:20015523-20015545 TTGTACCTCAGAAAAATCTTTGG + Intergenic
1024744690 7:52392561-52392583 CTGTGCATATGTAAAATATTAGG + Intergenic
1024844195 7:53622523-53622545 TTCTTCCCATGGAAAATCTATGG + Intergenic
1027854921 7:83498905-83498927 TTAATCCTGTCTAAAATCTTGGG + Intronic
1028210239 7:88064799-88064821 AAGTTCCAATGTAAAAACTTTGG + Intronic
1030397422 7:109004350-109004372 TTGTTCCCATTTAAAAAGTTAGG - Intergenic
1030560087 7:111074458-111074480 TTGGTCCTATGTAAAATACATGG + Intronic
1030917432 7:115333097-115333119 TTGTACACATGTAAAACCTTAGG + Intergenic
1031747827 7:125525802-125525824 ATGTTTCTATGTAAAATACTTGG - Intergenic
1032617067 7:133484621-133484643 TTTTTCCTATGAGAAATCTGAGG - Intronic
1033128596 7:138726287-138726309 GTGTTTCTATTTAAAATCTTCGG - Intronic
1035076768 7:156183754-156183776 TTGTTTCAATGTAACTTCTTCGG - Intergenic
1036695340 8:10970767-10970789 TTGCTCCTTTATAAAATCTAAGG - Intronic
1037015043 8:13893608-13893630 TTGTGCCTATTCATAATCTTAGG + Intergenic
1039185998 8:34916917-34916939 TTGTTCGTATGTGAAATCATGGG + Intergenic
1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG + Intergenic
1040972754 8:53154880-53154902 TTGTTGTTATTTAAAATCTGAGG - Intergenic
1042435747 8:68762825-68762847 TTCTTCCTATAGAACATCTTGGG + Intronic
1042784199 8:72529070-72529092 GTATTCCTATGAAAAATCTCTGG - Intergenic
1042884346 8:73531307-73531329 ATGTTCCTTTGTGATATCTTTGG - Intronic
1043245170 8:77990302-77990324 TTGTTCCCAAGTAAATTCATAGG + Intergenic
1043564287 8:81531125-81531147 TTTTTCCTATGTGAAAAATTAGG + Intronic
1044340847 8:91044764-91044786 TTGTTCCACTGTTAAATGTTGGG - Intergenic
1045730807 8:105238733-105238755 TTGTTAAAATGCAAAATCTTGGG - Intronic
1046124491 8:109887208-109887230 TTGTTCCTCTAAGAAATCTTTGG + Intergenic
1047691706 8:127361781-127361803 TTGTTAATATATTAAATCTTTGG + Intergenic
1048825084 8:138416671-138416693 TTGCTCAAAAGTAAAATCTTTGG - Intronic
1050311433 9:4357120-4357142 TTGTTCTTATTTAAAATCTTTGG + Intergenic
1053336967 9:37283373-37283395 ATGTAGATATGTAAAATCTTGGG - Intronic
1056104307 9:83331880-83331902 TTGATCCTGGGTAAGATCTTGGG + Intronic
1058809432 9:108625376-108625398 TTCATCCTATGGAAAATCTCTGG - Intergenic
1058875107 9:109237495-109237517 TTGTTCATTTGTGAACTCTTTGG + Intronic
1060349112 9:122842163-122842185 TTGATCTTATCTAAAATCTCGGG + Intergenic
1060911135 9:127352041-127352063 CTGTTCCTATGTAAAATGAAGGG + Intronic
1186300186 X:8192238-8192260 TTGATTCTCTCTAAAATCTTAGG + Intergenic
1186911889 X:14176161-14176183 TTGTTCTTAAATAAAATTTTAGG + Intergenic
1187353935 X:18548783-18548805 TTGTTTCTGTATAACATCTTCGG - Intronic
1188344899 X:29052259-29052281 TTACTCCTAGGGAAAATCTTGGG + Intronic
1189338986 X:40190089-40190111 TTCTATCTATTTAAAATCTTTGG + Intergenic
1193214391 X:78845592-78845614 TTGTTCCTATATAAATTTTAGGG - Intergenic
1194059992 X:89183966-89183988 TTGTTGCTCTATAAAATCTTTGG + Intergenic
1195716586 X:107824949-107824971 TTGTTCCTATGCACAATGATGGG + Intergenic
1196322903 X:114363903-114363925 TTGTTCTTATGTCCATTCTTTGG + Intergenic
1197501433 X:127246565-127246587 TTGTTCCTTTTTAAAATGTTAGG - Intergenic
1198030020 X:132745903-132745925 TTTTTCTTACTTAAAATCTTAGG + Intronic
1200365893 X:155663143-155663165 TTGGTTGGATGTAAAATCTTTGG - Intronic