ID: 924068891

View in Genome Browser
Species Human (GRCh38)
Location 1:240255048-240255070
Sequence ACGATTGCAGGAGTCTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 1, 2: 24, 3: 44, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924068886_924068891 -2 Left 924068886 1:240255027-240255049 CCGCGGGGTTCTCCCATGGCTAC 0: 1
1: 0
2: 1
3: 8
4: 98
Right 924068891 1:240255048-240255070 ACGATTGCAGGAGTCTGTGGTGG 0: 1
1: 1
2: 24
3: 44
4: 186
924068877_924068891 27 Left 924068877 1:240254998-240255020 CCCAATGTTAGCCTCAGGGCCTG 0: 1
1: 0
2: 6
3: 31
4: 243
Right 924068891 1:240255048-240255070 ACGATTGCAGGAGTCTGTGGTGG 0: 1
1: 1
2: 24
3: 44
4: 186
924068880_924068891 16 Left 924068880 1:240255009-240255031 CCTCAGGGCCTGTGCAGGCCGCG 0: 1
1: 0
2: 1
3: 21
4: 246
Right 924068891 1:240255048-240255070 ACGATTGCAGGAGTCTGTGGTGG 0: 1
1: 1
2: 24
3: 44
4: 186
924068884_924068891 8 Left 924068884 1:240255017-240255039 CCTGTGCAGGCCGCGGGGTTCTC 0: 1
1: 0
2: 1
3: 6
4: 77
Right 924068891 1:240255048-240255070 ACGATTGCAGGAGTCTGTGGTGG 0: 1
1: 1
2: 24
3: 44
4: 186
924068878_924068891 26 Left 924068878 1:240254999-240255021 CCAATGTTAGCCTCAGGGCCTGT No data
Right 924068891 1:240255048-240255070 ACGATTGCAGGAGTCTGTGGTGG 0: 1
1: 1
2: 24
3: 44
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924068891 Original CRISPR ACGATTGCAGGAGTCTGTGG TGG Intronic
903533336 1:24049011-24049033 AGGATTGCCTGAGTCTGGGGAGG + Intergenic
904462460 1:30688234-30688256 AGGATTGAAGGAGTGTGTAGAGG + Intergenic
906231674 1:44169805-44169827 AGGCTTGCAGGAGTCTGCAGTGG + Intergenic
906573070 1:46861706-46861728 AGTATTGTAGGAGTCCGTGGTGG - Intergenic
906598801 1:47105458-47105480 AGTATTGTAGGAGTCCGTGGTGG + Intronic
907220001 1:52899505-52899527 ACCATTAGATGAGTCTGTGGGGG - Intronic
907300841 1:53485509-53485531 ACGAGGGAAGGGGTCTGTGGGGG + Intergenic
907493621 1:54826672-54826694 AGGATTGCAGGAGCCTGTGCGGG + Intronic
908070431 1:60454477-60454499 AGGGTTGAAGAAGTCTGTGGTGG - Intergenic
909403166 1:75257584-75257606 AGAATTGCAGGAGTTTGTGTTGG - Intronic
909519641 1:76552248-76552270 AGGATTGCTGGAGTCTGTGGTGG + Intronic
909773828 1:79459221-79459243 AGAATTGCAGGTGTCCGTGGAGG - Intergenic
910156592 1:84225738-84225760 AGGATTGCAAGAGTCTGTGGTGG + Intronic
910344679 1:86222838-86222860 AGGCTTGTAGCAGTCTGTGGTGG - Intergenic
910546236 1:88422595-88422617 AGGATTGCAGAGGTCTATGGTGG - Intergenic
912561588 1:110555367-110555389 AGGTCTGCAGGGGTCTGTGGGGG + Intergenic
915625928 1:157114172-157114194 ACATTTGCAGGCGTCTGTGCGGG + Intergenic
916639485 1:166711702-166711724 AGAAGTGCAGGTGTCTGTGGTGG - Intergenic
917379576 1:174390631-174390653 GCTATTGCAGAAGTCTGGGGAGG + Intronic
917390460 1:174530520-174530542 AGGATTTCAGGAGTCCATGGTGG + Intronic
918999063 1:191804364-191804386 AGGATTGCAGTAGTCTGTGGTGG + Intergenic
919112943 1:193242350-193242372 AGGATTGCAGGAGTCTGAGGTGG + Intronic
919478503 1:198057039-198057061 AGGATTTCAGGAGTCCATGGTGG + Intergenic
919493600 1:198236633-198236655 ACTACGGTAGGAGTCTGTGGAGG - Intronic
921372982 1:214444620-214444642 CAGATTGCAGGAGTCTAAGGGGG + Intronic
921582544 1:216911984-216912006 AGGATTGCTGGAGGCTGAGGTGG + Intronic
921818079 1:219586562-219586584 AGGATTGCAGGAGTCCATGGTGG + Intergenic
923503503 1:234585837-234585859 TCGAATGCATGAGTCAGTGGGGG + Intergenic
923943818 1:238860162-238860184 ATGACTTCAGGTGTCTGTGGTGG - Intergenic
924068891 1:240255048-240255070 ACGATTGCAGGAGTCTGTGGTGG + Intronic
924648415 1:245901864-245901886 AGGATGGCAGGCATCTGTGGTGG - Intronic
1063302914 10:4868145-4868167 AAGACTACAGCAGTCTGTGGTGG + Intergenic
1064884380 10:20093495-20093517 ATGATAGCAGCAGTCTTTGGTGG + Intronic
1065825315 10:29565494-29565516 ACGATGGCAGGAGGCTGGAGAGG - Intronic
1065952097 10:30661420-30661442 ACGATGGCAGGAGGCTGGAGAGG + Intergenic
1066015020 10:31232825-31232847 AGGATTGCAGGTATCTGTGGTGG - Intergenic
1066037675 10:31509307-31509329 AGGATTGCAGGAGTCCATGGTGG + Intronic
1066097197 10:32083713-32083735 AGGATTGCTTGAGTCTGGGGAGG + Intergenic
1066167818 10:32807670-32807692 AGGATTGGAGGAATCTATGGTGG - Intronic
1067906200 10:50294155-50294177 AGAATTGCAGGAGTCTGTGGTGG - Intergenic
1069606884 10:69744323-69744345 TCGTTTCCAGGAGTCTCTGGTGG - Intergenic
1069893937 10:71668792-71668814 GTGATTGGAGGAGCCTGTGGTGG - Intronic
1071959440 10:90795824-90795846 AAGCTTGCAGGGATCTGTGGGGG + Intronic
1072758076 10:98033864-98033886 AAGAATGAAGAAGTCTGTGGGGG - Intergenic
1073645026 10:105293278-105293300 AAGATTGCAGGAGTCCATGGTGG - Intergenic
1073706443 10:105989593-105989615 AGGATTGCAGGAGTCCATGGTGG - Intergenic
1073709803 10:106023116-106023138 ACAATTGCTGGTGTTTGTGGTGG + Intergenic
1076086667 10:127637841-127637863 AGGATTGCAGGAGTCTGTGGTGG + Intergenic
1077451092 11:2645973-2645995 AGGATTTCAGGAGTCTGCTGTGG + Intronic
1077547780 11:3183288-3183310 AGGATTTCAGGAGGCTGAGGTGG - Intergenic
1078043408 11:7890591-7890613 ACTATTACTGAAGTCTGTGGTGG + Intergenic
1080432049 11:32208466-32208488 CAGATTTGAGGAGTCTGTGGGGG - Intergenic
1083004955 11:59335489-59335511 AAGATTGCAGGAGTTCTTGGTGG - Intergenic
1083010388 11:59391837-59391859 ATGGTAGCTGGAGTCTGTGGGGG - Intergenic
1083094114 11:60232558-60232580 AAGACTGCAGGTGTCTATGGTGG - Intronic
1083518525 11:63283719-63283741 AGGACTACAGGAGTCTGTGGAGG + Intronic
1085994493 11:81894003-81894025 AGGATTACAGGAGTCTGTAATGG + Intergenic
1086616724 11:88830616-88830638 AGTATTGCAGGAATCCGTGGTGG - Intronic
1086806316 11:91247249-91247271 ACGTTTGCATGTGTGTGTGGAGG + Intergenic
1087155116 11:94894497-94894519 AGGATTTCAGGTGTCTGTGGTGG + Intergenic
1088424917 11:109692798-109692820 AGGATTGCAGGAATCCATGGTGG - Intergenic
1088907247 11:114164069-114164091 ACGATTGCGGCAGTGTCTGGAGG + Intronic
1089951684 11:122534199-122534221 ATGACTGCAAGTGTCTGTGGTGG - Intergenic
1091597713 12:1890106-1890128 AGGATTGCAGGAATCCATGGTGG - Intronic
1092578296 12:9813806-9813828 ACGACTGCAGGAGTCTGCGGTGG - Intergenic
1092907802 12:13117793-13117815 TAGATTGCAGGTGTCTCTGGGGG + Intronic
1093263715 12:16973560-16973582 AGAATTGCAGGCATCTGTGGTGG + Intergenic
1095636562 12:44440964-44440986 AAAATTTCAGGAGTCTTTGGGGG - Intergenic
1095832568 12:46603559-46603581 AGGGTTGCAGGAGTCCATGGTGG - Intergenic
1095910667 12:47423644-47423666 AGGATTTCAGGGGTCTGTGGTGG - Intergenic
1097029656 12:56081598-56081620 AAGATTGCAGGAGTCTGGATGGG - Intronic
1097555284 12:61128426-61128448 AGGATTGCAGGAGTCAATGTTGG + Intergenic
1099519502 12:83642690-83642712 AGGATTGTAGGAGTCCATGGTGG + Intergenic
1100466349 12:94849207-94849229 AAGATTGCAGGAGTCCGTGGTGG - Intergenic
1102436233 12:112926145-112926167 CTGATGGCAGGAGCCTGTGGGGG + Intronic
1104522015 12:129485098-129485120 ACCAGTGCAGGAGAGTGTGGTGG + Intronic
1106987573 13:35373051-35373073 AGGACTGCAGGAGTCCATGGTGG + Intronic
1107223863 13:38022149-38022171 TGGATTGCAGGGGTCTGTGGTGG + Intergenic
1109618665 13:64871824-64871846 AGGATTGCAGGAGTCCATGATGG - Intergenic
1109808217 13:67471495-67471517 AGGATTGCAGGAGTCTGTAGTGG + Intergenic
1112204105 13:97306918-97306940 AGGATTTCAGGAATGTGTGGAGG + Intronic
1113237031 13:108288821-108288843 ACGAGTTCAGGAGTATCTGGAGG + Intronic
1114268166 14:21084926-21084948 ACGATTCCTGGAGTGAGTGGTGG + Intronic
1116208144 14:41895723-41895745 ACCATTAAAGGAGTCAGTGGGGG + Intronic
1117759954 14:59015972-59015994 AAGATTGCAGGAGTCTGTAGTGG + Intergenic
1120130975 14:80807613-80807635 CAGATTGCAGCAGTTTGTGGTGG - Intronic
1124204057 15:27702251-27702273 AGGACTGCAGGGGTCTGGGGTGG + Intergenic
1126203454 15:46015370-46015392 AGGATTGTAGGAGTCTGCAGTGG + Intergenic
1129026563 15:72580453-72580475 GGGATTGCTGGATTCTGTGGTGG + Intronic
1129080391 15:73034119-73034141 ATAATTGAAGGAGTCTGTAGTGG - Intergenic
1130786566 15:87104172-87104194 AGAATTGCAGGAGTCCATGGTGG - Intergenic
1132263755 15:100448436-100448458 AGGATTGCAGGAGTCCATGATGG - Intronic
1132604025 16:786150-786172 GCGACTGCAGCAGTGTGTGGGGG + Exonic
1132606994 16:797742-797764 CCGAGTGCAGGTGTGTGTGGGGG + Exonic
1139666768 16:68462819-68462841 AGGATTGCAGGACTCAATGGTGG + Intergenic
1141080570 16:81048034-81048056 AAGACTACAGGTGTCTGTGGTGG - Intergenic
1143868710 17:9942701-9942723 AGGAGTGAAGGAGTCTGCGGGGG + Intronic
1144275860 17:13667597-13667619 ATGTTTGCAGGAGTCTATGGTGG - Intergenic
1147458123 17:40551438-40551460 AGGGTTGCAGGAGGGTGTGGGGG - Intergenic
1149181941 17:53950406-53950428 AAGATTGCAGCAGTCCATGGTGG - Intergenic
1149308819 17:55374400-55374422 ACGATTCCACATGTCTGTGGAGG - Intergenic
1151348523 17:73517957-73517979 GCGATCTCAGGAGTCTGAGGAGG - Intronic
1153104609 18:1511877-1511899 AGGATTCCAGGAGTCTGTGGGGG + Intergenic
1154945540 18:21158160-21158182 AGGATTGCAGGAGTCAATAGTGG + Intergenic
1156100023 18:33581995-33582017 ACAACTGCAGAAGGCTGTGGGGG - Intronic
1158493435 18:57931165-57931187 AGTATTGCAGTAATCTGTGGGGG - Intergenic
1158735511 18:60075044-60075066 AGGATTGCAGGAGTCTGTGCTGG - Intergenic
1159064024 18:63549649-63549671 AAGATTGTAGGAATCTTTGGAGG + Intergenic
1160020787 18:75179063-75179085 AGGATTGCTTGAGTCTGAGGGGG + Intergenic
1160505461 18:79423975-79423997 AGGATTTCAGGAGTCAGAGGGGG - Intronic
1160583511 18:79900662-79900684 ACGGCAGCAGGAGTCTGTAGGGG + Intergenic
1162842739 19:13368224-13368246 AGGATTGCTTGAGTCTGGGGAGG + Intronic
1163737102 19:18988238-18988260 AACAGTGCAGGAGCCTGTGGTGG - Intergenic
1167301119 19:48678315-48678337 GGGAGTCCAGGAGTCTGTGGTGG + Intergenic
1167719670 19:51169823-51169845 GTGTTTGGAGGAGTCTGTGGAGG - Intergenic
1167756713 19:51417412-51417434 ACGAGTGCAGGAGTCAGTGATGG - Exonic
926348757 2:11975635-11975657 AGGATTACAGGAGTCTGTGGTGG + Intergenic
928066917 2:28174614-28174636 GGGATTGCAGGACTCTGTGGTGG - Intronic
928757994 2:34548182-34548204 AGCATAGCAGGAGTCTGAGGTGG + Intergenic
928838464 2:35575917-35575939 AGAATTGCAGGTGTCTGTGGTGG + Intergenic
929266164 2:39920902-39920924 GAGATCGCAGGAGTCTGTGGTGG + Intergenic
929346427 2:40890101-40890123 AGGATTGCAGGAGTTTGCAGTGG - Intergenic
930290741 2:49490476-49490498 AGGATTGCAGGAGGCTGAGGTGG - Intergenic
936093898 2:109517388-109517410 AGGCTTGCAGGAGTCTCTGCTGG + Intergenic
936504399 2:113093575-113093597 AACATTGCAGGAGTCTGTCCAGG - Intergenic
936974871 2:118208744-118208766 TCGATAGCAAGTGTCTGTGGTGG + Intergenic
937890088 2:126931886-126931908 AGGATTGCAGGAGTCCATGGTGG + Intergenic
937998970 2:127716919-127716941 ACGACTGCTGGAGCCTGTGCGGG + Intronic
943980141 2:194539401-194539423 AAGATTGCAGGTGTCTGTAGTGG - Intergenic
944498222 2:200329940-200329962 ACGATTGCAGAAGTCTGACTTGG + Intronic
946782344 2:223204901-223204923 AGGACTGCAGGAGTCTGTGGTGG - Intergenic
946878224 2:224151324-224151346 ACGACTGCAGGAGGCTAGGGTGG - Intergenic
946939805 2:224758792-224758814 AGGATTGCAGAAGTCTGTGGTGG + Intergenic
947043284 2:225949103-225949125 AGGATTGCAGGAGTCTGCAGAGG - Intergenic
947580382 2:231312485-231312507 AGGATGGCAGGAGTTTGTGGCGG + Intronic
948855553 2:240728723-240728745 AACATTGCAGGATCCTGTGGAGG + Intronic
1170111450 20:12808436-12808458 ATGAGGGCAGGAGTCTGTGATGG - Intergenic
1170611466 20:17917146-17917168 AAGATTGCTTGAGTCTGAGGGGG + Intergenic
1173266489 20:41487760-41487782 ACCCTTGCAGAACTCTGTGGAGG - Exonic
1173295048 20:41748567-41748589 AGGATTGCAGAGGTCTGTGGTGG + Intergenic
1175001126 20:55631877-55631899 AGGATTGCTTGAGTCTGGGGAGG - Intergenic
1177730365 21:25021271-25021293 ACGATTGCAGGAGCCTGTGATGG - Intergenic
1178687053 21:34720194-34720216 AGGATTGCTTGAGCCTGTGGTGG - Intergenic
1180728055 22:17960995-17961017 ACCACTGCAGGAGTCTGAGCAGG + Intronic
1182029086 22:27143511-27143533 AGGATTGGAGGACTCTGAGGTGG + Intergenic
1182698664 22:32212953-32212975 AGGGTTGCAGGAATCTGTGGTGG + Intergenic
949904170 3:8844539-8844561 GAGGTTGCAGGAGTCTGGGGTGG - Intronic
951676879 3:25250867-25250889 AAGACTGCAGGAGTCTGTGGTGG + Intronic
953220775 3:40969710-40969732 AGGATTGCAGGAGTCTGTGTTGG + Intergenic
954213418 3:49111083-49111105 GCGCTTGCAGGAGTTTGTGTTGG - Exonic
958855196 3:99376590-99376612 AGGATTGTAGGAATCTGTGGTGG - Intergenic
958960834 3:100508136-100508158 AGGATTGCAGTAGTCCATGGTGG - Intronic
959195251 3:103172210-103172232 AGGATTGCTTGAGTCTGGGGAGG - Intergenic
960087412 3:113605913-113605935 AGGATTGCTTGAGCCTGTGGAGG + Intronic
965839518 3:172887489-172887511 AGGACTGCAGGAGTCTGCAGTGG + Intergenic
965875724 3:173316878-173316900 AGGGTTTCAGGAGTCTCTGGTGG + Intergenic
967627402 3:191702703-191702725 AGGGTTGCAAGAGTCTGTAGTGG - Intergenic
967835163 3:193956224-193956246 AGGATTGCAGGTATCTGTGGTGG + Intergenic
970135980 4:12924571-12924593 AAGATTTCAGGTGGCTGTGGAGG + Intergenic
970757343 4:19442800-19442822 AGGATTGTAGGAGTCTGTGGTGG - Intergenic
971024200 4:22571821-22571843 AGGATTACAGGAGTCCATGGTGG + Intergenic
971756196 4:30711559-30711581 AGGATTGCAGGTGTCTATAGAGG + Intergenic
972251803 4:37309679-37309701 AGAATTGCAGGTGTCTGTGGTGG + Intronic
975226420 4:71877605-71877627 TGGATTGCAGCAGTCTGTGGTGG + Intergenic
977462845 4:97346927-97346949 ACTAGTGCAGGAGTCAGAGGGGG + Intronic
979684378 4:123495472-123495494 AATATTGGAGGAATCTGTGGTGG + Intergenic
980339340 4:131522702-131522724 AGAATTGCAGGAGTCTGCAGTGG + Intergenic
982072618 4:151708750-151708772 ACGAAGTCAGGAGTCTGTGGTGG + Intronic
983025250 4:162728530-162728552 AAGATTGGAGGTGTCTGGGGAGG - Intergenic
983163924 4:164451735-164451757 AGGATTGCAGGAATTTGTGGTGG - Intergenic
984788496 4:183592020-183592042 ACACGTGCAGGAGTCTATGGAGG + Intergenic
986750085 5:10779459-10779481 AGTATTGCAGGAGTCTGTGGTGG - Intergenic
987438922 5:17932317-17932339 AGGTTTACAAGAGTCTGTGGTGG - Intergenic
993022181 5:82605230-82605252 CGGATTGCAGAAGTCTGTAGTGG - Intergenic
993342248 5:86738944-86738966 AGGATTGCAGGTGTCCCTGGTGG + Intergenic
993402200 5:87467423-87467445 TGGATTGTAGCAGTCTGTGGTGG + Intergenic
993941301 5:94062542-94062564 AGGATTGCAGGGGTCTGTGGTGG - Intronic
994428184 5:99621974-99621996 AGGACTGCCGGTGTCTGTGGCGG - Intergenic
997837187 5:137204790-137204812 GAGATTGCAGGGGTCAGTGGAGG - Intronic
997979009 5:138457611-138457633 ATCATCGCAGGAGGCTGTGGGGG - Intergenic
998689094 5:144567113-144567135 AGGATTGCAGGTGCCTGTGATGG + Intergenic
999935926 5:156485922-156485944 AGGATTGCAGGAGTCCCTGGTGG - Intronic
1000030984 5:157401337-157401359 AGGATTACAGGAGTCTGTAGTGG - Intronic
1000418126 5:161005597-161005619 AGGATTGCAGGCATCTGTGATGG + Intergenic
1001364426 5:171122641-171122663 AGGACTGCAGGAGTCTGCAGTGG - Intronic
1005592916 6:27347790-27347812 AGGATTCCAGGAGTCCATGGTGG - Intergenic
1008125995 6:47669074-47669096 ACGATTGCTGAAGACTGGGGCGG - Intronic
1009295321 6:61940359-61940381 AGGATTGCAGGAGTCCATGGTGG - Intronic
1010269014 6:73900551-73900573 AGGAATGCAGGAGTTTGTTGAGG - Intergenic
1010332886 6:74645796-74645818 AGGATTGCAAGAGCCTGTTGTGG - Intergenic
1011117225 6:83906522-83906544 AGGATTGCATGAGTCCATGGTGG + Intronic
1011323984 6:86129238-86129260 AGGATTGCAGGCATCTGTGGTGG - Intergenic
1014119586 6:117708146-117708168 AGGATTGAAGGCCTCTGTGGGGG + Exonic
1014479044 6:121912242-121912264 AGGACTGCAGGTGTTTGTGGTGG + Intergenic
1014676023 6:124367452-124367474 TCGATTCCAGCACTCTGTGGTGG + Intronic
1016583467 6:145656391-145656413 AGGTTTGCAGGAGTTGGTGGTGG - Intronic
1017336631 6:153268767-153268789 AGGGTTGCATGAGTCTGTGGTGG - Intergenic
1018198785 6:161377080-161377102 TGGATTCCAGGTGTCTGTGGAGG + Intronic
1018349584 6:162943054-162943076 AGGATTGCAGAAGTCCATGGTGG - Intronic
1019127968 6:169853830-169853852 ATAATTGGAGGAGTGTGTGGGGG + Intergenic
1019905065 7:4056601-4056623 CGGATTGCAGGAGTCTGTGGTGG - Intronic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1022292912 7:29021613-29021635 AAAATTATAGGAGTCTGTGGTGG - Intronic
1022985523 7:35650352-35650374 AGGATTACAGGAGTCTGCAGTGG - Intronic
1023049567 7:36239356-36239378 ACGCATGCCGGAGTCTGTGTTGG + Intronic
1024015755 7:45312528-45312550 AGGATTGGAGGAGTCTGTGATGG + Intergenic
1026074865 7:67156914-67156936 AGGGTTGCAGGTGTCAGTGGTGG + Intronic
1026701993 7:72655248-72655270 AGGGTTGCAGGTGTCAGTGGTGG - Intronic
1027251140 7:76399622-76399644 AGGATCGCTGGAGTCTGGGGGGG - Intronic
1028344212 7:89760483-89760505 AGGATTGCAGGAGTCCATGGTGG - Intergenic
1028492894 7:91432989-91433011 AAGATTGCAGGCATCTGTGGTGG + Intergenic
1028777271 7:94692534-94692556 AGGATTGTAGGAGTCTGTGATGG - Intergenic
1030687767 7:112504375-112504397 AAGATTGCTGGAGTTCGTGGTGG + Intergenic
1033872473 7:145772127-145772149 AGAATTGCAGGCATCTGTGGTGG + Intergenic
1035293575 7:157854992-157855014 ACCATTGCAGGGGTGTGTGTGGG + Intronic
1035293613 7:157855130-157855152 ACGGTTGCAGGGGTGTGTGCGGG + Intronic
1035293626 7:157855176-157855198 ACCATTGCAGGGGTGTGTGTGGG + Intronic
1035293638 7:157855222-157855244 ACCATTGCAGGCGTGTGTGCGGG + Intronic
1036913893 8:12785867-12785889 ACGATTGCAGGTGTGTGTTATGG + Intergenic
1038133291 8:24758422-24758444 AAGACTGCAGGTGTCTGTGGTGG - Intergenic
1041484420 8:58358950-58358972 AGGGGTGCAGGTGTCTGTGGTGG - Intergenic
1042854056 8:73247196-73247218 ACTAATGCAGGAGGGTGTGGAGG - Intronic
1044467542 8:92525309-92525331 AGGATTGCAGGAGTCCATGGTGG - Intergenic
1044884744 8:96765270-96765292 AGGTTTGCAGGATTCTATGGTGG + Intronic
1046302656 8:112317742-112317764 AAGATTGCAGGAGGCTTTGATGG - Intronic
1046440991 8:114254722-114254744 AGGATTGCAGAAGTCCATGGTGG - Intergenic
1047624723 8:126644926-126644948 AAGATTGGAGGAGTCTCTGATGG + Intergenic
1048424133 8:134306881-134306903 GCCATGGCAGAAGTCTGTGGGGG - Intergenic
1050439969 9:5651135-5651157 AGGGTTGCAGGAGTCCGTGGTGG + Intronic
1050676630 9:8063011-8063033 AGGATTGCAGGAGTTTTTGTTGG + Intergenic
1051916006 9:22208894-22208916 GAGGATGCAGGAGTCTGTGGTGG + Intergenic
1052715714 9:32114690-32114712 ACGATTGAAGAAGCCTATGGAGG + Intergenic
1053031033 9:34777937-34777959 AGGATTGCAGAAGTCTGTGGTGG + Intergenic
1056002325 9:82230535-82230557 AGGATTGGAGGAGTCCATGGAGG - Intergenic
1056739002 9:89236496-89236518 CTGATTGCAGGAGTCTTTGGAGG - Intergenic
1057154482 9:92829195-92829217 AGAATTGCAGGAGTTTGTGGTGG - Intergenic
1059860849 9:118459837-118459859 AAGATTCCAGGAGGCTGTTGTGG + Intergenic
1062148954 9:135007617-135007639 TGGATTGCAGGAGTCTAGGGAGG + Intergenic
1187305694 X:18093453-18093475 GGGATTGCAGGTGTATGTGGAGG + Intergenic
1187464002 X:19512961-19512983 ACGAATCCAGGAGACAGTGGAGG + Intronic
1188041083 X:25370155-25370177 AAGATTGCAGGAGTCCAAGGTGG + Intergenic
1188758024 X:33987938-33987960 AGGATTTTGGGAGTCTGTGGTGG + Intergenic
1189888913 X:45578018-45578040 AGGACTGCAGAAGTCTGTGGTGG + Intergenic
1190000180 X:46678543-46678565 ACTCTTGGAGGAGTCTGAGGTGG - Intronic
1190892824 X:54586235-54586257 AGGATTGTAGGAGTCCATGGTGG - Intergenic
1190924834 X:54894057-54894079 AGGATTGCAGGTGTCTACGGTGG - Intergenic
1191034216 X:56007459-56007481 AGGATTACAGGAGTCTGTGGTGG + Intergenic
1191226896 X:58053745-58053767 AGGATTGCAAGGGTCTATGGTGG - Intergenic
1191684738 X:63878683-63878705 AGGATTGCAGGAGTCTTCAGTGG - Intergenic
1192840389 X:74849385-74849407 GAGATTGCAGGAGTCTGCAGTGG - Intronic
1194255032 X:91624617-91624639 AGGATTGTAGAAGTCTGTGGTGG + Intergenic
1195870691 X:109482207-109482229 AAGAAGGCAGTAGTCTGTGGAGG - Intergenic
1196310799 X:114162646-114162668 AGGATTGCAGGAGTCTACCGTGG + Intergenic
1196677073 X:118430963-118430985 AAGGTTACAGGAGTCTGTGTTGG + Intronic
1198318418 X:135493620-135493642 AGGATTGCAGGAATTTATGGTGG + Intergenic
1200573817 Y:4864220-4864242 AGGATTGCAGAAGTCTGTGGTGG + Intergenic