ID: 924071439

View in Genome Browser
Species Human (GRCh38)
Location 1:240284353-240284375
Sequence TGAGTTAGAAACAAACAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924071427_924071439 27 Left 924071427 1:240284303-240284325 CCCATATCACTCCCTAATATGAG 0: 1
1: 0
2: 0
3: 4
4: 110
Right 924071439 1:240284353-240284375 TGAGTTAGAAACAAACAGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 247
924071437_924071439 4 Left 924071437 1:240284326-240284348 CCAATCTTTTAAGCTGGGGGGGA 0: 1
1: 0
2: 2
3: 4
4: 58
Right 924071439 1:240284353-240284375 TGAGTTAGAAACAAACAGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 247
924071428_924071439 26 Left 924071428 1:240284304-240284326 CCATATCACTCCCTAATATGAGC 0: 1
1: 0
2: 0
3: 9
4: 87
Right 924071439 1:240284353-240284375 TGAGTTAGAAACAAACAGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 247
924071430_924071439 15 Left 924071430 1:240284315-240284337 CCTAATATGAGCCAATCTTTTAA 0: 1
1: 0
2: 2
3: 24
4: 225
Right 924071439 1:240284353-240284375 TGAGTTAGAAACAAACAGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 247
924071429_924071439 16 Left 924071429 1:240284314-240284336 CCCTAATATGAGCCAATCTTTTA 0: 1
1: 0
2: 0
3: 13
4: 178
Right 924071439 1:240284353-240284375 TGAGTTAGAAACAAACAGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924071439 Original CRISPR TGAGTTAGAAACAAACAGTC AGG Intronic
903880666 1:26506900-26506922 TGTGTTAAAAACAAAAAGGCAGG + Intergenic
905304372 1:37007355-37007377 AGTGTTAGAAGCAAAGAGTCAGG - Intronic
907692489 1:56683418-56683440 TGTATTGGGAACAAACAGTCTGG + Intronic
907717284 1:56938922-56938944 TGAGTTGGAAATATACACTCTGG - Intronic
909999470 1:82325191-82325213 TGAGTGAGAGAGAAACAGACAGG + Intergenic
910511013 1:88004332-88004354 TGAGTTAAAAGCAAAAACTCAGG + Intergenic
910617918 1:89219838-89219860 TGAGCTCCAAACAAAGAGTCTGG + Intergenic
912135753 1:106658740-106658762 AGAGATAGAAAAAAACAGGCTGG + Intergenic
916874133 1:168950729-168950751 TGGTTTAGAAACAAAGAGGCTGG - Intergenic
917029757 1:170676801-170676823 TGAGTTAGGAATGAAGAGTCTGG + Intronic
917102162 1:171457226-171457248 TGAGTTAGAGAAAAGCAGTTTGG - Intergenic
917220360 1:172722058-172722080 TGAGATAGAAATAATCACTCTGG - Intergenic
918330606 1:183456798-183456820 TCAGTTAAAAACAGACTGTCAGG + Intergenic
920863497 1:209731642-209731664 TGAGTGAGAATTAACCAGTCTGG + Intronic
922042923 1:221914808-221914830 TTAGGTAGAAAGAAACAGCCCGG - Intergenic
922187165 1:223285990-223286012 AAAGTTAAAAACAAAAAGTCCGG + Intronic
923269969 1:232346741-232346763 TGAGTTGGAAACACCCGGTCAGG + Intergenic
923645163 1:235812885-235812907 TGAATCAGAATCAAACATTCAGG + Intronic
923827627 1:237517317-237517339 TGAGTTATAAACACACTATCAGG - Intronic
924071439 1:240284353-240284375 TGAGTTAGAAACAAACAGTCAGG + Intronic
1063051703 10:2456677-2456699 TAAGTTGGAAAGAAACAGTTGGG - Intergenic
1063474634 10:6317691-6317713 TGAGATAGAAACAAATAATGAGG - Intergenic
1063898799 10:10710547-10710569 TGATTAAGGAACAAACAGTTTGG + Intergenic
1064808398 10:19164103-19164125 TGAGTTAGAAACAAAAATAATGG - Intronic
1066451235 10:35532253-35532275 AGAGTTAGAAACAGTCATTCAGG + Intronic
1068079292 10:52299806-52299828 TGAGTTAGAAAGGAGAAGTCTGG - Intergenic
1068736112 10:60415185-60415207 TGGGGTAGAAAGAGACAGTCTGG + Intronic
1069161259 10:65095115-65095137 AAAGTTGGAAACAAAGAGTCTGG + Intergenic
1069174054 10:65268240-65268262 TGAGGGAGAAACAAACAGTGAGG - Intergenic
1069489835 10:68851836-68851858 TGTCTTAAAAACAAACAGCCGGG + Intronic
1070296110 10:75162819-75162841 TGAGTTAGTAATAAGCACTCAGG + Intronic
1073803172 10:107065954-107065976 GGTGCTAGAATCAAACAGTCTGG - Intronic
1074546807 10:114407691-114407713 TGAGATGGTAACAAACAGCCTGG - Intergenic
1076423842 10:130353148-130353170 TTACTCAGAAACAAACAGTTAGG + Intergenic
1077548175 11:3185754-3185776 TGAGTTAGAAATAAACTTTTGGG + Intergenic
1077737140 11:4803473-4803495 GGAGTTAGAACCAAACAGATCGG - Exonic
1079166717 11:18050771-18050793 TGAGTTTGAAACACACATTTTGG - Intergenic
1080182257 11:29439490-29439512 AGAGGTAGAAAAAAACTGTCAGG + Intergenic
1082850879 11:57763756-57763778 TGAGTGGGAAACAGACACTCTGG - Intronic
1083356790 11:62072426-62072448 TCAGTTAGAAAGAAAGAGACGGG - Intergenic
1084443594 11:69190452-69190474 TTAGTTTGAAAAAAACAGACAGG + Intergenic
1084750317 11:71200340-71200362 TGAGTAATAAATAAACAGTGTGG - Intronic
1085113820 11:73912348-73912370 TGAGATGGAAAAAAACAGTTTGG - Intronic
1085591786 11:77769531-77769553 TGAAGGAGAAAGAAACAGTCAGG + Intronic
1087338510 11:96873130-96873152 TGATTCAGAAACAAGTAGTCTGG - Intergenic
1087650537 11:100861824-100861846 TGAATTAGAAACAAACATTTGGG + Intronic
1087665983 11:101048136-101048158 TGAGTTAGCAAGAAACACCCAGG - Intronic
1088348553 11:108858519-108858541 TGTGTTAGATACATCCAGTCTGG - Intronic
1088559383 11:111097369-111097391 TTATTCAGAAAGAAACAGTCCGG + Intergenic
1090757735 11:129808576-129808598 TCAGTAAGAAAAAAACAGCCGGG + Intergenic
1093296555 12:17399113-17399135 TGAGTATGAAACAAATAGTCAGG - Intergenic
1095685248 12:45025806-45025828 TGAGTTCGGAGAAAACAGTCAGG + Intronic
1095716144 12:45348707-45348729 TGAGGAAGAAACTTACAGTCAGG - Intronic
1097533548 12:60836838-60836860 TCAGGTAGAAAAAAACATTCAGG + Intergenic
1101787552 12:107898371-107898393 TGAAATTGAAACAAACACTCAGG + Intergenic
1102539447 12:113608110-113608132 TGAGTGAGAAACAAACTGCTGGG + Intergenic
1105339470 13:19506471-19506493 TGAGTTAAAAACAAAGATTTAGG - Intronic
1107789058 13:43982406-43982428 TGAGTTAGAAACAGAAAATGAGG - Intergenic
1108172089 13:47751941-47751963 TGCTTTAAAAACCAACAGTCTGG - Intergenic
1109661944 13:65471781-65471803 TTATTTAGAAAAAAACAGTCTGG - Intergenic
1110081305 13:71316943-71316965 TGATTTATAAACACTCAGTCAGG + Intergenic
1110925514 13:81146347-81146369 TGAGTTAAAAAAAAATATTCTGG - Intergenic
1111807305 13:93053597-93053619 TGAATTAGAAATAATCACTCCGG - Intergenic
1113128419 13:107006843-107006865 TGAGTTAGAAACACCCAGAGTGG - Intergenic
1114471996 14:22969598-22969620 AGAGTAAGAAACAAAGGGTCAGG + Intronic
1115078875 14:29425978-29426000 TTACTCAGAAACAAACAGCCAGG + Intergenic
1117011784 14:51478032-51478054 TGCTATAGAAAAAAACAGTCTGG - Intergenic
1118426575 14:65670889-65670911 TGAGTTAAAAATAAAAAATCGGG - Intronic
1123131691 14:105991799-105991821 TGAGTTAGGGAAAAACAGCCAGG - Intergenic
1124572646 15:30879693-30879715 TGATTTAAAAAAAAAAAGTCAGG + Intergenic
1124582516 15:30972250-30972272 TGAGTTAAAAACAAAAATTATGG - Intronic
1125082972 15:35697195-35697217 TCAGTGAGAAACAACTAGTCAGG - Intergenic
1126621409 15:50643887-50643909 TGAGTTAGAAACATTAAGACTGG + Intronic
1130351617 15:83097407-83097429 TGAAGGAGAAGCAAACAGTCAGG + Intergenic
1138159659 16:54741294-54741316 TGGGTTAGAAACAGAGACTCCGG - Intergenic
1138850408 16:60622313-60622335 TCAGTTAGAAACAAAGAGCAGGG + Intergenic
1139746189 16:69076536-69076558 TGAGTAAGAAAGATGCAGTCGGG + Intronic
1140429799 16:74892651-74892673 TGAGTGATAACCAAAGAGTCAGG - Intronic
1141788097 16:86215120-86215142 TGAGTCAGAAACAGACAGATTGG + Intergenic
1143145059 17:4769824-4769846 TGAGTCAGAGACAAATAGTTGGG + Intergenic
1143856151 17:9851154-9851176 TAATTTAGAAACAAATAGTTAGG + Intronic
1144756796 17:17684645-17684667 TAAGTGAGTAACAAAAAGTCTGG - Intronic
1146367017 17:32236989-32237011 TTATTTAGAAACAAAGATTCTGG + Intronic
1146697186 17:34918565-34918587 TAGGTTAGAAACAAGCAGTCAGG + Intergenic
1147495873 17:40914671-40914693 TGAGTCAGAAATAGACACTCAGG - Intergenic
1148339096 17:46862891-46862913 TGAGTTTTAAACAAAGACTCAGG + Intronic
1150436024 17:65154886-65154908 TGAGTGAAAAATAAATAGTCAGG - Intronic
1152528257 17:80902059-80902081 TGAGTGAGAAACAAGCAGGATGG - Intronic
1154147422 18:11877806-11877828 TGAGTTAGAAAGTAACAATGAGG + Intronic
1154436655 18:14348509-14348531 TGAGATAGAGAGAAACTGTCTGG - Intergenic
1156174213 18:34522955-34522977 TGAGTTATAAACTAAGCGTCAGG + Intronic
1156398461 18:36719936-36719958 TGAGTGAGAAACACACACTGGGG - Intronic
1157134561 18:45041005-45041027 AGAGCTAGAAACACACAGGCTGG + Intronic
1160591849 18:79949363-79949385 TGACTTAAAAACTAACAGGCGGG + Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1167589038 19:50392771-50392793 TCATTAAGAAACAAACAGCCTGG - Intronic
1167976331 19:53229414-53229436 TAAGTTAAAAAAAAACAGTAAGG - Intergenic
1168679207 19:58301425-58301447 AGAGTGTGAACCAAACAGTCTGG + Exonic
926110298 2:10178525-10178547 TGTGTTAGAAACAAACAGGAGGG - Intronic
927159096 2:20241639-20241661 AGAGAGAGAAACACACAGTCTGG + Intergenic
928162633 2:28942210-28942232 TGAGTTAGCAGCAAGCAGTGGGG + Intronic
929378390 2:41318839-41318861 TGAGTTTGAAACGAACATTAGGG + Intergenic
931290892 2:60872527-60872549 TGAAAAAGAAACAAAGAGTCTGG + Intergenic
931385250 2:61792667-61792689 TGAGTTTGAAAGAAACAGGAAGG + Intergenic
934863892 2:97788668-97788690 GGAGTTAGAATCACACAGACTGG + Intronic
935099502 2:99979506-99979528 TAAGTTAGAAACAGGCAGGCTGG + Intronic
937617434 2:123942934-123942956 TGAGTAAGAGACAAACAGCAGGG + Intergenic
937640076 2:124202467-124202489 TGAGTGGTAAACAACCAGTCAGG + Intronic
937702172 2:124876005-124876027 GGAGTGAGAAACAGACAGACTGG - Intronic
939791979 2:146588856-146588878 TGAGTTAGCAACATACTGTGTGG - Intergenic
941169526 2:162119631-162119653 TGTGTTAGAAAGAAACTGCCTGG + Intergenic
941736812 2:168986675-168986697 GGAGCTGGAAACAAAAAGTCTGG - Intronic
941976885 2:171415162-171415184 TTAGGTAGAAAAAAAAAGTCAGG + Intronic
943294088 2:186115128-186115150 TCAGTTAGAAACAAAGAATGGGG - Intergenic
943816271 2:192260245-192260267 TCAATTAGAAACAAACATTATGG - Intergenic
943856859 2:192806801-192806823 GAAGTTAGAAACACACACTCTGG + Intergenic
945013276 2:205487425-205487447 TCAGTTAGAAGAGAACAGTCAGG - Intronic
945038532 2:205725138-205725160 TGAGTGACAAAGAAACAGTATGG + Intronic
1170636253 20:18107184-18107206 TAAGAAAGAAATAAACAGTCTGG - Intergenic
1171332875 20:24356954-24356976 TGAGATGGAACCAAACAGTGCGG + Intergenic
1171787394 20:29481050-29481072 AGAGTTAGAAAGAAGCAGTTTGG - Intergenic
1171976314 20:31596870-31596892 TGAATTAGAAATAAACAGCCTGG - Intergenic
1173381650 20:42549957-42549979 TCAATTTGAAACAAACAGTCTGG - Intronic
1173997887 20:47353354-47353376 TGAGTCAGAAAGAAACAATTGGG - Intronic
1177315278 21:19452459-19452481 TGAGTTGCAAACTAAAAGTCTGG - Intergenic
1177481171 21:21691061-21691083 TGAGTTAGAGAAAAACATTTGGG - Intergenic
1178688309 21:34728972-34728994 TTAGAAAGAAACAAATAGTCTGG + Intergenic
1178754344 21:35334302-35334324 GGACTAAGAAACAAACAATCAGG + Intronic
1179789311 21:43747298-43747320 TGAGTTAAAAACCCACAGGCAGG - Intronic
1180190196 21:46159225-46159247 TGAGTTATACAGGAACAGTCTGG - Intergenic
1180364447 22:11926124-11926146 TGACTTAAAAAAAAAAAGTCTGG - Intergenic
1180841492 22:18960898-18960920 TGAGATAGAACCAAGCAGTAGGG - Intergenic
1181059998 22:20277896-20277918 TGAGATAGAACCAAGCAGTAGGG + Intronic
1181770935 22:25125052-25125074 TGAATACGAAACCAACAGTCAGG - Intronic
1182530029 22:30948162-30948184 AGAGTAAGAAACAGACATTCAGG + Intronic
1184462425 22:44646785-44646807 TGAGTTAGAAGCAGTTAGTCAGG + Intergenic
1184990014 22:48161052-48161074 TGAGTCAGGAACAAAAAGCCAGG + Intergenic
1185204783 22:49531647-49531669 TGGATTAGAAACAGACAGCCAGG - Intronic
950245788 3:11417316-11417338 TGAGGTAAAAACTAACAGTACGG - Intronic
951653881 3:24982672-24982694 AGAGTTAAACAAAAACAGTCAGG - Intergenic
953948184 3:47166427-47166449 TGAATGAGAAAAAAGCAGTCAGG + Intergenic
959637406 3:108590567-108590589 TGGGTTAGAAACTGCCAGTCAGG + Intronic
962012442 3:131405314-131405336 AGAGTTAGATCCAAACAGCCTGG - Intergenic
962392587 3:134985074-134985096 AGAGTCAGAAACCAAGAGTCAGG - Intronic
962895408 3:139709576-139709598 TGACTTAGGAAGAAATAGTCTGG + Intergenic
963697886 3:148584799-148584821 TGAGTTACCATCCAACAGTCTGG + Intergenic
964707564 3:159635823-159635845 AGATTTAGAAATAAACATTCAGG + Intronic
964937007 3:162102276-162102298 TGACTCAGAAACACAAAGTCAGG + Intergenic
966485839 3:180468883-180468905 TCAGTTAGAAACAAAGAATGGGG + Intergenic
966512834 3:180783279-180783301 TGAGACAGAAGCAAACAGACTGG - Intronic
967291825 3:187928611-187928633 CTAGTTAAAAACAAACAGCCTGG + Intergenic
967861238 3:194153448-194153470 CCAGTTAGAGAGAAACAGTCTGG - Intergenic
973073833 4:45898467-45898489 TGAGTTAGTACCTAACATTCAGG - Intergenic
973695764 4:53489175-53489197 TGAGCTAAAAGCAATCAGTCTGG + Intronic
974259469 4:59506869-59506891 TAAATTATAAACATACAGTCTGG + Intergenic
974613890 4:64255581-64255603 TGATTTAGAAACAAACTGTGGGG + Intergenic
976067766 4:81208792-81208814 TCATTTGGAAACAAACAGCCTGG + Intronic
976150979 4:82091420-82091442 AGAGTAAGAAACAGGCAGTCTGG - Intergenic
978023503 4:103843440-103843462 GCAGTTAGAAACCAACAGTCTGG + Intergenic
978618393 4:110617616-110617638 TATGTTAGAAACATACAGTGTGG + Exonic
982191434 4:152859687-152859709 TGAGTTTGATACAAAAAGTAAGG - Intronic
982456905 4:155620834-155620856 TGAGTCAGAAAGATACAGTGAGG - Intergenic
982743369 4:159081017-159081039 AGAGAAAGAAACAAAGAGTCCGG - Intergenic
983233347 4:165151554-165151576 TGTATTAGAAACAAGGAGTCTGG - Intronic
984172835 4:176381291-176381313 TGATTTAGAAGCAAGCAATCTGG - Intergenic
984303887 4:177962195-177962217 AGAGTTTGAAACAGACAATCTGG + Intronic
985355335 4:189113124-189113146 TGAATTATTAACAAAAAGTCAGG - Intergenic
986592586 5:9386715-9386737 AGACTTAGAAACAAAAGGTCTGG - Intronic
988131979 5:27118698-27118720 TGTGTTATAAACAAAGAGTTTGG - Intronic
989314762 5:40065140-40065162 AGATTTAGATACAAAAAGTCTGG - Intergenic
989509449 5:42267587-42267609 TGAGGTTGAAAAAACCAGTCTGG - Intergenic
991461415 5:66863306-66863328 TGTTTTAGAAACAAACACTGTGG - Intronic
991477860 5:67042591-67042613 CGTGTTAGAAACAAATAGTAGGG + Intronic
992121549 5:73598731-73598753 TGAGTTTGGAACTAACAGACAGG + Intergenic
993173451 5:84451633-84451655 TCAGTTAGAAACAAAGAATGAGG + Intergenic
996489955 5:124082537-124082559 TGACTTAAATATAAACAGTCTGG - Intergenic
997429420 5:133827164-133827186 TGAGGCAGAAACAAGCAGGCAGG - Intergenic
999355661 5:150928446-150928468 TCAGTTAGAAACAAAAGGTGGGG - Intergenic
1000397185 5:160788178-160788200 AGAGTTAGAGACAGACAGTCTGG + Intronic
1002378306 5:178805034-178805056 TGGGTTATAAACAAACTGTCTGG - Intergenic
1004021225 6:11777218-11777240 TGAGCTAGAATTAAAAAGTCAGG + Intronic
1009515231 6:64607639-64607661 TGAGGGAGATACAAACACTCAGG + Intronic
1009755872 6:67939595-67939617 TACGTTAGAATCACACAGTCAGG + Intergenic
1010277255 6:73983670-73983692 TCATTTAGAAACAAATAGTTGGG + Intergenic
1011328499 6:86177225-86177247 TGAGTCAGAAACAGACATTTTGG + Intergenic
1011713329 6:90077519-90077541 TGTGTTAGGAACCATCAGTCTGG - Intronic
1013836487 6:114341909-114341931 TGAGAGAGAAACAGACAGGCAGG + Intronic
1014597466 6:123362543-123362565 TGAGTTAGAAAAAAATATCCTGG - Intronic
1014601466 6:123418409-123418431 TGATTTAGAAATAAAAATTCAGG + Intronic
1015546518 6:134367189-134367211 TGGGTTAAAAACTACCAGTCTGG - Intergenic
1015949210 6:138534607-138534629 TAAGTTAGAAATAAACAGCAGGG - Intronic
1018128606 6:160706232-160706254 TTAGTTAAGAACACACAGTCGGG - Intronic
1018600847 6:165539301-165539323 AGAGTTAGAAAAAAAGACTCTGG + Intronic
1018654851 6:166025229-166025251 TGAGGGAGACACAAACACTCAGG + Intergenic
1020191819 7:6005913-6005935 GGAGTTAGTAGAAAACAGTCTGG - Exonic
1021078435 7:16334056-16334078 TCAGTTAGAAACAAAAAATGGGG + Intronic
1021953777 7:25803128-25803150 TGAGATGGTAAAAAACAGTCAGG + Intergenic
1022702156 7:32771758-32771780 TGAGTTAATAACAAACAGTTGGG - Intergenic
1022906393 7:34861900-34861922 TGAGTTAAGAACAAACTGTTAGG - Intronic
1023448930 7:40260972-40260994 TGAGATAGAAAAAAAAAGTGGGG - Intronic
1024677935 7:51654694-51654716 TGACTTTGAAACAAGCACTCAGG - Intergenic
1025143729 7:56486416-56486438 TTATTTAAAAACAAACAGGCCGG - Intergenic
1026090819 7:67299306-67299328 GGAGTTAGTAGAAAACAGTCTGG - Intergenic
1026433549 7:70372528-70372550 TGAAATGGAAACAAACAGTAGGG + Intronic
1027120414 7:75514666-75514688 GGAGTTAGTAGAAAACAGTCTGG - Intergenic
1027271484 7:76522034-76522056 GGAGTTAGTAGAAAACAGTCTGG + Intergenic
1027321250 7:77011976-77011998 GGAGTTAGTAGAAAACAGTCTGG + Intergenic
1028042159 7:86066478-86066500 TGAGTTCCAAACAAAGAGGCTGG + Intergenic
1028319718 7:89444012-89444034 TGATTTTGAAAGAAACAGACTGG - Intergenic
1029399205 7:100332463-100332485 GGAGTTAGTAGAAAACAGTCTGG - Intergenic
1029440302 7:100583597-100583619 TGAAGTAGAAACAATCTGTCAGG + Intronic
1030896205 7:115063420-115063442 GGAGTTAGAACCAAAAAGTGAGG - Intergenic
1031394614 7:121257535-121257557 GGAGTTAGCCAAAAACAGTCAGG + Intronic
1031534102 7:122912565-122912587 TGAGTTAGTAACATATAGTTTGG - Intergenic
1032093674 7:128926441-128926463 GGAGTTAGATACCAAGAGTCAGG - Intergenic
1032485946 7:132287706-132287728 TCAGTCAGAAAAAAACAGTGGGG + Intronic
1032772873 7:135077177-135077199 TGAGTTAGCAACAGACAGCAGGG - Intronic
1033351047 7:140562342-140562364 AAAGTTGGAAACAATCAGTCTGG - Intronic
1034584725 7:152079173-152079195 TGAGGTAGAAAAGAACAGTAAGG - Intronic
1037377827 8:18250904-18250926 TCAGTTAGAAACAAAGAATGAGG + Intergenic
1039136077 8:34324038-34324060 TGAGTAAGAAATATACAGTATGG + Intergenic
1040666912 8:49644656-49644678 TTAGTTAGAAATAAGCACTCTGG + Intergenic
1041512717 8:58669525-58669547 TCAGTTAAAAACCAACAGTAGGG + Intergenic
1043513046 8:80968541-80968563 TGAGCAAGATACAAACATTCTGG + Exonic
1043709027 8:83391075-83391097 TGACTTAGAAACAATGACTCAGG - Intergenic
1044341750 8:91054138-91054160 TGGGTTAAAATCAAGCAGTCAGG + Intergenic
1044622458 8:94203706-94203728 TAAGCTAGAAACAAGCAGACAGG + Intronic
1044831903 8:96258890-96258912 TCAGTTACAAACCAACAGACAGG + Intronic
1045692581 8:104774776-104774798 TGAGTTAAAAAAAAAAAATCTGG + Intronic
1046313206 8:112465676-112465698 TCAGTTAGAAAAAAAGAGGCTGG + Intronic
1046616080 8:116478738-116478760 TGAATTAAAAACAAACAGTGAGG + Intergenic
1050312286 9:4365952-4365974 TGAGTTTGAAACAAAGAATTTGG - Intergenic
1050611609 9:7359783-7359805 TGAGTTAGAAACAACCAATTTGG - Intergenic
1052747118 9:32451765-32451787 TAAATTACAAACAAACAGCCAGG + Exonic
1054075561 9:60525648-60525670 TGTGTGAGGAACAAACATTCAGG + Intergenic
1055396813 9:75884491-75884513 TGAGTTAATAAAATACAGTCAGG - Intergenic
1056203233 9:84296512-84296534 TGAGTCAGAAACATGCATTCGGG - Intronic
1056422758 9:86445623-86445645 TTAATTAGAAAAAAACAGCCAGG + Intergenic
1057533000 9:95870935-95870957 TGAGCTAGAAGAAAAAAGTCTGG - Intergenic
1057618113 9:96611353-96611375 TGTATTAGAGACAAACAGACTGG - Intronic
1058759932 9:108120773-108120795 TGAATTAGAAACAATCACTCTGG + Intergenic
1058962683 9:110006662-110006684 TTAGTTAGAAATACACACTCAGG - Intronic
1059560768 9:115332660-115332682 TGACTCAGAAACAAAAAGTCAGG - Intronic
1059637088 9:116181700-116181722 TGAGTCAGAAACCATCAGGCAGG + Intronic
1203447993 Un_GL000219v1:78535-78557 AGAGTTAGAAAGAAGCAGTTTGG - Intergenic
1185481512 X:449959-449981 TCATTTAGAAAAAAACAGCCAGG - Intergenic
1185870185 X:3658285-3658307 TGTTTCAGAAACAAACAGACCGG - Intronic
1188219916 X:27528306-27528328 TGTGTGAGAAACATACATTCTGG - Intergenic
1188607927 X:32055893-32055915 TTTGTTAGATACAAACAGACAGG - Intronic
1188906070 X:35793474-35793496 AGAGGTAGCAACAAAGAGTCTGG + Intergenic
1189058474 X:37726456-37726478 TGAGTTAGGAACCGACAGCCTGG - Intronic
1190028480 X:46948385-46948407 TGAGTTAGCATCAAACAATCTGG - Intronic
1190856484 X:54300154-54300176 TGTCTTAAAAACAAACAGGCTGG - Intronic
1192172333 X:68864834-68864856 AGAGTGAGAAACAAAGACTCTGG - Intergenic
1192873169 X:75204374-75204396 TGAGTTAAGAACATACACTCTGG - Intergenic
1193140495 X:78021908-78021930 TTATTTAGAAAGAATCAGTCGGG - Intronic
1193283255 X:79681407-79681429 TGAGAGAGAAACATACAGTTAGG - Intergenic
1193503240 X:82306764-82306786 GTAGTTAGAAATTAACAGTCAGG + Intergenic
1193511717 X:82410399-82410421 TCAGTTAGAAACAAAGAATAGGG - Intergenic
1193933186 X:87582288-87582310 AGAGATAGAAAAAAACAGTCTGG + Intronic
1195917011 X:109945874-109945896 TGAGTAAGAAATATAGAGTCCGG + Intergenic
1197220129 X:123904235-123904257 CGAGTTAAAAACAAACAAACAGG - Intronic
1197787362 X:130212246-130212268 CTAGTTAGAAACAAACAGTTGGG + Intronic
1199258423 X:145743970-145743992 AGAGATAGAGAAAAACAGTCTGG + Intergenic
1199710527 X:150465989-150466011 TTAGTCAGAAACACCCAGTCTGG + Intronic
1199851019 X:151725029-151725051 TGAGTTGCAAACAAACAGCACGG + Intergenic
1199860062 X:151793380-151793402 TGACTTAGAGGCAGACAGTCTGG - Intergenic
1201075439 Y:10184054-10184076 AGAGAGAGAAACAGACAGTCAGG - Intergenic