ID: 924073804

View in Genome Browser
Species Human (GRCh38)
Location 1:240311512-240311534
Sequence ATTCACCTTAAGCACGTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 49}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924073804_924073805 7 Left 924073804 1:240311512-240311534 CCATAAACGTGCTTAAGGTGAAT 0: 1
1: 0
2: 0
3: 4
4: 49
Right 924073805 1:240311542-240311564 TTAAAAAAAAAGAAAAGCTTTGG 0: 1
1: 6
2: 86
3: 905
4: 6846

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924073804 Original CRISPR ATTCACCTTAAGCACGTTTA TGG (reversed) Intronic