ID: 924074003

View in Genome Browser
Species Human (GRCh38)
Location 1:240314056-240314078
Sequence AAAGCTACTAAGGAAGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924074003 Original CRISPR AAAGCTACTAAGGAAGATGC TGG Intronic
902661639 1:17908342-17908364 AGAGGTAGTAAGGAAGAGGCAGG + Intergenic
903424654 1:23244916-23244938 GAAGGTCCTAAAGAAGATGCAGG + Intergenic
903464065 1:23539915-23539937 AAAGGAACTAACGAAGACGCAGG - Intergenic
904289735 1:29476938-29476960 AAAGATATTAAAGAAGATGTTGG - Intergenic
905279639 1:36841022-36841044 AAAGCTAATGAGGAAGAACCGGG + Intronic
906029071 1:42702849-42702871 AAAGCTGCTTAGGAACATGGAGG + Intergenic
907387265 1:54134197-54134219 AAAGCTCCTAAGGTGGAGGCAGG - Intronic
909685753 1:78346552-78346574 AAAGCTACTCAGGATGGTGGTGG + Intronic
910341482 1:86193404-86193426 CATGCTGCTAAGGCAGATGCTGG - Intergenic
913347929 1:117826682-117826704 AAATCTAGTAAAGAAGATGATGG - Intergenic
914829253 1:151158742-151158764 GAAGCTACTGAGTAAGATGGCGG + Exonic
915453344 1:156022271-156022293 ACAGATACTAAGGCAGATACAGG - Intergenic
915911098 1:159916075-159916097 AAAGCAATTAAGGGAGAAGCAGG - Intergenic
916857418 1:168764630-168764652 AAAACTACAAAGCAAGATTCAGG - Intergenic
917722719 1:177801273-177801295 ACAGCTTCTAAGAATGATGCTGG - Intergenic
918378182 1:183929911-183929933 AAAGCTACTAAGGAGTTTCCTGG - Intronic
919657092 1:200207833-200207855 GAAGCTACTAAGGAGGTTGAAGG - Intergenic
920078064 1:203351430-203351452 AAAGCCACAAAGGCAGATGCAGG + Exonic
920838199 1:209531547-209531569 ACAGCTCCTAAAGAAGGTGCTGG + Intergenic
920899442 1:210092258-210092280 AAAGCTAGGAAGGCAGAAGCAGG - Intronic
921929703 1:220745303-220745325 AATTCTACAAATGAAGATGCTGG + Intergenic
923865913 1:237939351-237939373 CCAGCAACTAAGGAAGATGCAGG + Intergenic
924074003 1:240314056-240314078 AAAGCTACTAAGGAAGATGCTGG + Intronic
924701665 1:246459937-246459959 AAAGCCACAAAGAAAGAAGCAGG + Intronic
924827138 1:247551577-247551599 AAATATACCAAAGAAGATGCAGG + Intronic
1063046563 10:2398460-2398482 CCAGCTACTAAGGAGGAGGCAGG + Intergenic
1064438272 10:15330225-15330247 CCAGCTACTAGGGAAGAAGCAGG + Intronic
1066151392 10:32623568-32623590 AAGGCAACTAAGGGAGAAGCAGG - Intronic
1069252249 10:66283420-66283442 AAATCTACATAGGAAGATGGTGG - Intronic
1069386669 10:67889386-67889408 ATAGCTCCTAAAGGAGATGCAGG + Intronic
1069480713 10:68779371-68779393 TAAGCTACTTAGGAAGCTGAGGG - Intronic
1071097870 10:82000046-82000068 AAAATTGGTAAGGAAGATGCTGG + Intronic
1075245508 10:120818697-120818719 AAAGCTTCAAAGGAGGGTGCAGG + Intergenic
1075641200 10:124065685-124065707 AAAGCTAATTTGGAAGAGGCAGG - Intronic
1077436246 11:2540540-2540562 CAAGCTACTGAGGAGGCTGCTGG - Intronic
1078369972 11:10736389-10736411 AAAGGAACTCAGTAAGATGCTGG + Intergenic
1078596624 11:12692760-12692782 AAAGCTACCAAAGAAAAAGCTGG + Intronic
1079021361 11:16911844-16911866 AAAGATAAAAAGGAAGAAGCAGG - Intronic
1081966434 11:47172975-47172997 AAAGACACTAAGGAAAATGTAGG + Intronic
1082299397 11:50488167-50488189 AAAGTTACTAATGAAGTTTCAGG + Intergenic
1083353932 11:62051307-62051329 AATGCCACTGAGGAAGAGGCGGG + Intergenic
1083785896 11:64946722-64946744 AAAGCTAATAAGAATGCTGCTGG - Intronic
1084304790 11:68274960-68274982 ACAGCTCCTAGGGAAGATACAGG + Intergenic
1087742575 11:101905782-101905804 AAAACTACTAAGGAATATGATGG - Exonic
1087998019 11:104835818-104835840 CAAGCTACTAAGAATGAAGCAGG - Intergenic
1088470211 11:110182071-110182093 AAAGCTGCTAAAGCAGCTGCTGG - Intronic
1088522925 11:110718531-110718553 TCAGCTACTGAGGAAGATGATGG - Intergenic
1089074870 11:115729714-115729736 GAAACTACTGAGGAAGATTCTGG - Intergenic
1090180852 11:124698129-124698151 CAAGTGACTAAGGAAGATGAGGG - Intergenic
1090270014 11:125379451-125379473 AGAGTTACCAAGGAAGTTGCGGG + Intronic
1091579319 12:1772869-1772891 GAAGCTCCTCAGGAAGATGAGGG + Exonic
1093201199 12:16188273-16188295 AAAGCTTCTAAGGAATATTAGGG + Intergenic
1094167517 12:27457552-27457574 AATGCTTCTCAGGAAGAGGCTGG - Intergenic
1096695355 12:53345109-53345131 AAAGCTACGGCGGAAGAGGCAGG - Intronic
1097008609 12:55936646-55936668 AAAGCCACTGAGGAAGCTGGGGG - Intronic
1102307615 12:111817673-111817695 AATGCCACTGAGGAAGAGGCGGG + Intergenic
1103318235 12:120074277-120074299 AAAGATAGTAGGGAAGATGAAGG - Intronic
1103783112 12:123412727-123412749 AAAGGTACTTAGAATGATGCAGG + Exonic
1103892070 12:124246821-124246843 AAAGCTGCTAGGGAAGCTTCAGG + Intronic
1104454412 12:128898940-128898962 AAAGCAAGAAATGAAGATGCAGG - Intronic
1104727551 12:131087417-131087439 GAAGCTACTGAGGAGGCTGCCGG - Intronic
1106513919 13:30436399-30436421 AAAGCTACTAAGCAAGAGAATGG - Intergenic
1110940576 13:81343576-81343598 AAAGCTAAGAAGAAAGATGAGGG + Intergenic
1114172526 14:20287798-20287820 AAAGCAACTAGGGAAGATGGGGG - Exonic
1114258063 14:21019059-21019081 CAAGCTCCTAGGGAAGATCCAGG + Intronic
1115669515 14:35593741-35593763 ACAGCTACTCAGGAAGCTGAGGG + Intronic
1115697957 14:35920942-35920964 TAAACTGCTATGGAAGATGCAGG + Intronic
1116511221 14:45749247-45749269 AAAGCTACTAGGAAATGTGCAGG - Intergenic
1117523291 14:56572588-56572610 ATAGCTAGGAAGGAAGATTCTGG - Intronic
1117557804 14:56904563-56904585 AAAGGTAGTAAGGAGGATGAGGG - Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120678740 14:87453655-87453677 AAAGCTCCTATGAAAGATGAAGG + Intergenic
1120769194 14:88360211-88360233 AAAGCTGCTTAGCAAGATGTTGG - Intergenic
1126403213 15:48295676-48295698 CAAGGTATTAAGGAAAATGCAGG + Intronic
1127313997 15:57777484-57777506 AAACCTTCTAAGGACCATGCAGG + Intronic
1128091998 15:64925582-64925604 ACAGCTGCTAATGAAGAAGCAGG - Intronic
1128300178 15:66561770-66561792 AAAGCAACCAGGGAAGAAGCTGG + Intronic
1128485726 15:68085604-68085626 AAAGCTACTAAGGAGTAGTCAGG - Intronic
1131417805 15:92276078-92276100 TGAGTTACTAAGGAGGATGCCGG - Intergenic
1133717684 16:8465226-8465248 AAGGCTACCAAGGGAGATACAGG + Intergenic
1137691830 16:50433708-50433730 AAAGCTGCAAAGGAAGATGATGG - Intergenic
1138140539 16:54564637-54564659 AAAGCAAGAAAGAAAGATGCTGG + Intergenic
1138519221 16:57561447-57561469 AAAGCCTCTCAGGAAGCTGCTGG - Intronic
1141050816 16:80761769-80761791 AAAAATACAAAAGAAGATGCTGG + Intronic
1141359904 16:83385990-83386012 ATAGCTACAAATGGAGATGCTGG - Intronic
1141867627 16:86761525-86761547 AATGCTACTAATAAAGATGATGG + Intergenic
1146332762 17:31941662-31941684 CAAGCTACTAAGGAGGCTGAAGG - Intronic
1147855452 17:43476350-43476372 GAAGGTCCTAAAGAAGATGCAGG + Intergenic
1148502836 17:48104768-48104790 AAAGCTACTCAGGAGGCTGAGGG - Intronic
1149802935 17:59587512-59587534 AAAGCTACTAAGGAGGCTGAGGG - Intronic
1149843551 17:59987966-59987988 AAAGCTACTAAGGAGGCTGAGGG + Intergenic
1149979430 17:61297984-61298006 AAAGCTACTGATGAAGCTGCAGG - Intronic
1152067737 17:78120919-78120941 AAACCTACTTAGGATGAGGCCGG - Intronic
1152113985 17:78373572-78373594 AAAGATGCTGAGGAGGATGCGGG + Intergenic
1152123152 17:78431284-78431306 AAAGCTGCTAAGCAAGATGCAGG - Intronic
1153681358 18:7504134-7504156 AATTCTACTAAGGTTGATGCAGG - Intergenic
1153747429 18:8194227-8194249 CAAGCTACCAAGGGAGATGAAGG - Intronic
1159659917 18:71082208-71082230 AATCCAACTGAGGAAGATGCAGG - Intergenic
1164883444 19:31756631-31756653 AAAGCTACTCGGGAAGCTGAAGG + Intergenic
1165085332 19:33341907-33341929 AAAGCTACTGGGGATGAGGCCGG + Intergenic
1166478085 19:43146365-43146387 CCAGCTACTCAGGAAGATGAGGG - Intronic
1167085940 19:47309811-47309833 AAAGCCCCAAGGGAAGATGCAGG - Intronic
924976197 2:177937-177959 ACAGGTGCTAAGGAACATGCAGG + Intergenic
927591856 2:24363458-24363480 AAAGACACTAAGGATGATGAAGG - Intergenic
929177398 2:38994477-38994499 AAAGCTACTAAAGAATTTGGTGG + Intronic
930830218 2:55734724-55734746 AAAGCTTCAAAGAAACATGCAGG + Intergenic
931505554 2:62922568-62922590 AAAGGTTATAGGGAAGATGCAGG + Intronic
935467216 2:103412737-103412759 GAAGCTAATAAGGAATATGCTGG - Intergenic
939295149 2:140253681-140253703 AAAGCTGATGAGGAAGATACAGG + Intronic
939560911 2:143730545-143730567 TAAGCCACTTAGGAAGTTGCTGG + Intronic
939854472 2:147341543-147341565 AAAGCCACTTAGAAAGATGAAGG - Intergenic
940219131 2:151333240-151333262 AAAGGTATAAAGGAAGATGCTGG + Intergenic
941038547 2:160594567-160594589 AAAAACACTAAGGAAAATGCAGG - Intergenic
942688676 2:178562040-178562062 GAAGCTTCAAAGGAAGATGTTGG - Exonic
943898999 2:193407861-193407883 ACAGCTAATAAGGAATATGAAGG + Intergenic
945253694 2:207786120-207786142 AATGCTGCTTAGGAAAATGCAGG + Intergenic
948305841 2:236946146-236946168 AAAATCCCTAAGGAAGATGCTGG - Intergenic
1168767298 20:390363-390385 AAAGGAACCAAGAAAGATGCTGG - Intronic
1168784740 20:528528-528550 CCAGCTACTAAGGAAGCTGAAGG - Intronic
1171967698 20:31542983-31543005 CAAGCTCCTAAGGAAGAGGCCGG + Intronic
1172197990 20:33105044-33105066 GAAGCAAATAAGGAAGGTGCTGG - Intronic
1174402995 20:50285912-50285934 AAGCCTGCTAAGGAGGATGCTGG - Intergenic
1174849210 20:53975823-53975845 GAAGCTACTCAGGAAAATTCTGG + Intronic
1177414352 21:20775459-20775481 AAATCAACTATGTAAGATGCAGG - Intergenic
1184238981 22:43201839-43201861 ACAGCTCCTGAGGAAGGTGCCGG - Exonic
949293787 3:2496697-2496719 AAAGTCACTAAGGAAGGTCCAGG + Intronic
950924774 3:16729499-16729521 AAAATTACTAAGGGAGATTCTGG + Intergenic
951798727 3:26571420-26571442 CAAGCTACTTAGAAAGATGAGGG + Intergenic
953264365 3:41371431-41371453 AAAGCTTCTGAGGAAGGAGCAGG + Intronic
954620755 3:51994054-51994076 AAAGGGCCTAAAGAAGATGCAGG - Exonic
955481508 3:59394876-59394898 AAAGCTACAAAAGAAGATTGGGG + Intergenic
958866230 3:99504740-99504762 CAAGTTACTAAGGAATTTGCTGG + Intergenic
960104587 3:113780903-113780925 AAACCTACTATGGAACATACTGG - Intronic
961559487 3:127718777-127718799 AAAGATATGAAGGAGGATGCAGG - Intronic
961837453 3:129674950-129674972 CCAGCTACTCAGGAAGAGGCAGG - Intronic
962485304 3:135836839-135836861 AAAGTTAATAAGAAATATGCAGG + Intergenic
963124223 3:141799920-141799942 AAAGTTACTAATGAGGATACTGG - Intronic
963211886 3:142701731-142701753 AAAGTTCCTAAGGGAGATGATGG - Intronic
968239420 3:197063255-197063277 AAAGCAACAAAGAAAGATGGGGG - Intronic
971349190 4:25841560-25841582 ACAGCTATTAATGAAGATGCTGG - Intronic
971913896 4:32842019-32842041 CCAGCTACTCAGGAAGATGAAGG - Intergenic
972255968 4:37355704-37355726 AAGACTACTAAGGAAGATTCTGG - Intronic
973007418 4:45030020-45030042 GAAGCTATAAAGAAAGATGCAGG + Intergenic
974632433 4:64510725-64510747 GAGCCTACTAAGGAAAATGCTGG - Intergenic
974683916 4:65199498-65199520 GGAGCTTCTAAGGATGATGCAGG + Intergenic
975101258 4:70515737-70515759 AAAGCTAATAAGAAAGATTAAGG + Intergenic
978647775 4:110959804-110959826 AAAGCTAAAAAGAAAAATGCTGG - Intergenic
978744180 4:112173382-112173404 AAAGCAACTAAGGAAAAAACAGG + Intronic
978923111 4:114209839-114209861 AAAGCTAAAAATGAAGATCCTGG - Intergenic
979583208 4:122384693-122384715 AAAGCTATTAGGGAAAAGGCAGG - Intronic
981245310 4:142529994-142530016 AAAGCTACATAGGAACATGCAGG + Intronic
983235408 4:165173579-165173601 CCAGCTACTAAGGAAGCTGAGGG - Intronic
989163127 5:38410532-38410554 AATCCTAGTAAGGAAAATGCCGG + Intronic
991720358 5:69489416-69489438 AATGCTACTAAGGAACGTGCGGG + Intergenic
991912643 5:71576808-71576830 AATGCCACTGAGGAAGAGGCGGG - Intergenic
992925345 5:81579098-81579120 AAAGATAGTTTGGAAGATGCTGG + Intronic
993928142 5:93898252-93898274 AAAGATAGTAAGGAAAATCCAGG - Intronic
995005365 5:107186895-107186917 AAAGAAAATGAGGAAGATGCAGG + Intergenic
996533440 5:124550577-124550599 AGAGCTACAAAAGAAAATGCAGG + Intergenic
997079932 5:130726160-130726182 AAATCTACTAAGGATGCTGCTGG + Intergenic
997375189 5:133392648-133392670 AAGGCTACCTAGGAGGATGCTGG + Intronic
998066660 5:139164727-139164749 AAAGCTAGTAAGGAAGAGGTGGG + Intronic
998342294 5:141428798-141428820 AAAGCTAATAATGAAGTTACTGG - Intronic
999099065 5:149007304-149007326 AATGCTACAAAAGAAAATGCAGG + Intronic
1003965787 6:11250888-11250910 AAAGGTAGTAAGGAATTTGCAGG - Intronic
1006982317 6:38156468-38156490 AGAGCTGCTTTGGAAGATGCAGG + Intergenic
1007469503 6:42079371-42079393 CAAGTTTTTAAGGAAGATGCTGG + Exonic
1007694521 6:43723920-43723942 AAGGCTAATGAGGAAGAGGCTGG + Intergenic
1009571825 6:65394887-65394909 AAAGCTTTTAAGGAAGAGGACGG - Intronic
1010304812 6:74307176-74307198 AAGGCCACCAAGGAATATGCTGG - Intergenic
1010372504 6:75127364-75127386 AAAGCTCCTAAGGGAAAAGCAGG - Intronic
1013471213 6:110468147-110468169 AAAACTACAAAGCAAAATGCAGG + Intronic
1014146020 6:117999127-117999149 AAAGGGCCTAAAGAAGATGCAGG + Intronic
1016730680 6:147424272-147424294 AAAGCTACTAAAGAATAGACAGG + Intergenic
1016977051 6:149819459-149819481 AAAGATGCTAAGCTAGATGCTGG + Exonic
1017542681 6:155418719-155418741 AAAACTTCTAAGTAAAATGCAGG - Intronic
1018560881 6:165099811-165099833 AAACCTCCTAGGGAAGAAGCTGG + Intergenic
1020113121 7:5459036-5459058 ACAGCTACTGAGGAAGCTGAGGG + Intronic
1022575895 7:31496672-31496694 AAAGATAGGAAGGAATATGCTGG + Intergenic
1023144224 7:37133379-37133401 AAACCTACTGAGGTGGATGCAGG + Intronic
1023281201 7:38572511-38572533 AAAGCCAATAAGGAAGAGTCAGG + Intronic
1023299107 7:38749975-38749997 ATAGCTACTCAGGAAGCTGAGGG - Intronic
1023336499 7:39176059-39176081 AAAGTTACAAAGGAAGAAGAGGG - Intronic
1024840526 7:53581313-53581335 AAAGATACTAAGGAAGAGATTGG - Intergenic
1027474678 7:78614445-78614467 AAAGCAACTAATGAATGTGCTGG - Intronic
1028614783 7:92754195-92754217 AATGTTACTGAGGAAGATGCTGG - Intronic
1030305800 7:108018080-108018102 AAAGAGACTAATGAGGATGCTGG + Intergenic
1030328972 7:108252741-108252763 CAAGCTATCAAGCAAGATGCAGG + Intronic
1031494160 7:122425485-122425507 CAAGCTACTCAGGAAGCTGAGGG + Intronic
1032817454 7:135491367-135491389 AAATCTACTAAGGAAGACTAAGG + Intronic
1038189193 8:25303498-25303520 CAAACTACAGAGGAAGATGCTGG - Intronic
1039112300 8:34053099-34053121 AAAGCTACTCAAGGAGATACTGG + Intergenic
1039663816 8:39497384-39497406 AAAGCTGGTATAGAAGATGCAGG + Intergenic
1045255455 8:100516826-100516848 AAAGCTACTGAGGATGCTGTTGG - Intronic
1045430915 8:102114465-102114487 AAAGCAATGAAGGATGATGCAGG + Intronic
1045791635 8:105990602-105990624 ATACCAACTAAGGAAGAGGCTGG - Intergenic
1046264260 8:111810855-111810877 AAAGCTAACAAAGAAAATGCAGG - Intergenic
1046302562 8:112315913-112315935 AAAACTACTAATGTAGTTGCTGG + Intronic
1048815137 8:138326116-138326138 AAAGCAGCAAAGGGAGATGCAGG - Intronic
1050194234 9:3063698-3063720 GAAGCTGCTCAGGCAGATGCTGG + Intergenic
1050257508 9:3810599-3810621 AAAGCTACTATGGGAAATCCTGG - Intergenic
1050792061 9:9485544-9485566 TAAGCAACTAAGGAAGTTGAAGG - Intronic
1051597406 9:18838944-18838966 ACAGCACCTAAGTAAGATGCTGG - Intronic
1056530950 9:87487144-87487166 AAAGAAAGTAAGGAAGAGGCGGG - Intergenic
1056800109 9:89685219-89685241 AAACCTTCTAAGGGAGAAGCAGG - Intergenic
1058176950 9:101747107-101747129 CAAGATACTAAAGAAGATCCTGG - Intergenic
1058829992 9:108807694-108807716 CAAGCTCCTAAGAAAAATGCAGG + Intergenic
1059338090 9:113581543-113581565 AAAGCTCCTACAGAAGATGGTGG - Intronic
1062175435 9:135159479-135159501 AGAGCTACTCTGGAAGAAGCAGG - Intergenic
1062531997 9:137006079-137006101 AAATGTTCTGAGGAAGATGCTGG + Intergenic
1188101023 X:26087896-26087918 AAAAGTACTAAGGAAGTTACAGG + Intergenic
1190283510 X:48946918-48946940 GTAGCTACTAAGTAAGATACTGG + Intronic
1191140160 X:57107860-57107882 AATGCCACTGAGGAAGAGGCAGG - Intergenic
1193212927 X:78828836-78828858 CAATCTAGTAAGGAACATGCAGG + Intergenic
1196757859 X:119173508-119173530 CAAGCTACTCAGGAAGCTGAGGG + Intergenic
1197901211 X:131374667-131374689 AAAGCTACTGAGAAATGTGCAGG + Intronic
1199579506 X:149347230-149347252 AAAGCTATAAAGGTAGATTCTGG + Intergenic