ID: 924074248

View in Genome Browser
Species Human (GRCh38)
Location 1:240316806-240316828
Sequence ATGCTATCATTGGGGAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 784
Summary {0: 1, 1: 2, 2: 30, 3: 178, 4: 573}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924074248_924074252 10 Left 924074248 1:240316806-240316828 CCAGTTTTCCCCAATGATAGCAT 0: 1
1: 2
2: 30
3: 178
4: 573
Right 924074252 1:240316839-240316861 TATAGTATAACATCAAAACCTGG 0: 1
1: 4
2: 68
3: 219
4: 603
924074248_924074253 23 Left 924074248 1:240316806-240316828 CCAGTTTTCCCCAATGATAGCAT 0: 1
1: 2
2: 30
3: 178
4: 573
Right 924074253 1:240316852-240316874 CAAAACCTGGAAAATTACATTGG 0: 1
1: 0
2: 30
3: 129
4: 627

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924074248 Original CRISPR ATGCTATCATTGGGGAAAAC TGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901095245 1:6673588-6673610 GTGCTAACATTGGGGGAACCTGG - Intronic
901210379 1:7521351-7521373 ATGTTACCACTGGGGGAAACTGG - Intronic
901725040 1:11235084-11235106 CTGCTATGACTGGGGAAAACAGG - Intronic
902162150 1:14539483-14539505 ATACTAACATTGGGGGAGACTGG + Intergenic
902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG + Intergenic
902421058 1:16280570-16280592 ATGCTAACATTAGGGAAACTGGG + Intronic
902795407 1:18797722-18797744 ATGTCACTATTGGGGAAAACTGG + Intergenic
903564105 1:24251657-24251679 ATGTTATCATTGTGGGAAGCTGG - Intergenic
903797247 1:25938659-25938681 ATGTTATATTTGGGGAAAACTGG - Intergenic
904551538 1:31323269-31323291 ATGTCACCATTGGAGAAAACTGG + Intronic
906807728 1:48795510-48795532 ATGTTACCATTGGAGGAAACTGG - Intronic
907413191 1:54296779-54296801 AGGCCACCCTTGGGGAAAACAGG - Intronic
907543980 1:55243214-55243236 ATGCTAACATTGGGGAGAAGGGG + Intergenic
908552294 1:65221618-65221640 AAGCTATGATGGGGGAAAAATGG + Intronic
908577150 1:65472293-65472315 GGGCTGTCATTTGGGAAAACGGG + Intronic
908663746 1:66466183-66466205 ATACTATGATTTGGGAAATCTGG - Intergenic
909504774 1:76376203-76376225 ATGTTATCATTGGAGAAAACTGG - Intronic
909523363 1:76594912-76594934 ATGCTAATAATAGGGAAAACAGG - Intronic
909553217 1:76923157-76923179 ATGTTACAATTGGGGAATACTGG + Intronic
909744011 1:79070229-79070251 ATGTTACCATTGAGGAAAAATGG + Intergenic
910227748 1:84953568-84953590 ATGTTAGTATTGGGGAAATCTGG + Intronic
912377426 1:109222269-109222291 ATGTTATCATTGGGGAAAACGGG - Intronic
912450288 1:109764096-109764118 AGGCTAGCAGTGGGGGAAACAGG - Intronic
913084185 1:115420228-115420250 ATGTCACCATTGGGGAAAACTGG - Intergenic
913267978 1:117063766-117063788 ACGTTACCATTGGGGGAAACTGG - Intronic
915710753 1:157895866-157895888 ATGTTACAATTGAGGAAAACTGG - Intronic
916255623 1:162784788-162784810 ATGTTATAAATGGGGAAAACTGG - Exonic
916724714 1:167512607-167512629 ATGCAATAATGGGGGAACACTGG - Intronic
917923942 1:179773460-179773482 ATGTTACCATTGGGGGAAACTGG + Intronic
918135269 1:181667931-181667953 ATGTTACCACTGGGGGAAACTGG - Intronic
918756827 1:188348623-188348645 ATGTTATTATTGGGAAAACCTGG - Intergenic
919040736 1:192384826-192384848 AAGCTATGATGGGGGAAAAAAGG + Intergenic
919556602 1:199063011-199063033 ATGGTATGATTAGGGAAAATAGG + Intergenic
919717388 1:200792893-200792915 GTGTTACCATTGGGGGAAACTGG + Intronic
919719979 1:200823359-200823381 ATGTTAACATTAGAGAAAACTGG - Intronic
920033995 1:203053940-203053962 ATGCCATCAATGAGGAAATCAGG + Exonic
920402572 1:205685623-205685645 ATGTTAACATTAGGGGAAACTGG + Intergenic
920404631 1:205700016-205700038 ATGTCATCAATGGGGGAAACTGG + Intergenic
920676623 1:208042621-208042643 ATTCTATCCTTGGGAAAATCAGG - Intronic
921120817 1:212135367-212135389 ATGTTACCTTTGGGGGAAACTGG + Intergenic
921185266 1:212665104-212665126 ATGCTATCGTTTGAGAAGACAGG + Intergenic
921340928 1:214133562-214133584 ATGTAACCATTGGGGGAAACTGG - Intergenic
921399158 1:214701615-214701637 ATGTTATCATTGGCGGAAACCGG - Intergenic
922636868 1:227182541-227182563 ATGTTACCATTGGGGGAAGCTGG - Intronic
922732146 1:227954256-227954278 CGGTTACCATTGGGGAAAACCGG - Intergenic
923347987 1:233075607-233075629 ATGTTATCCCTGGGGGAAACTGG + Intronic
923451961 1:234126379-234126401 ATGTTACCATTGGTGGAAACTGG - Intronic
923456942 1:234172948-234172970 ATGTTACCATTGGGGGAAGCTGG - Intronic
923720797 1:236465062-236465084 ATGCGATCACTGGGGAAAACAGG - Intronic
923849223 1:237775242-237775264 ATGTCAGCATTGGGGAAAGCTGG - Intronic
923994336 1:239475688-239475710 ATGCTAATAATAGGGAAAACTGG + Intronic
924074248 1:240316806-240316828 ATGCTATCATTGGGGAAAACTGG - Intronic
924310339 1:242734821-242734843 ATGTTATCATTGAGGGAAACTGG + Intergenic
924418182 1:243881353-243881375 ATGTAACCAATGGGGAAAACTGG - Intergenic
924641257 1:245835753-245835775 ATGGGATCATTAGGAAAAACAGG + Intronic
1063050407 10:2441118-2441140 ATGGGATCCTTGGAGAAAACTGG + Intergenic
1063511775 10:6652092-6652114 ATGCTATCCATGGTTAAAACTGG - Intergenic
1064034895 10:11907310-11907332 ATGCCACCATTGGGGGAAGCTGG + Intergenic
1065227568 10:23560371-23560393 ATGTTATCATTGGGTGAAACTGG - Intergenic
1065821945 10:29533704-29533726 ATGCTATCCTGGGGGAGAATGGG + Intronic
1066036515 10:31492993-31493015 ATGTTACCATTGGAGGAAACTGG - Intronic
1066722086 10:38350457-38350479 ATGTTGTAAATGGGGAAAACTGG - Intergenic
1067100695 10:43332336-43332358 ATGTTATCATTGGGGGAAACTGG + Intergenic
1067241940 10:44504899-44504921 ATGTTACCATTGGGGGAAACTGG + Intergenic
1067248495 10:44566583-44566605 ATGCTACCATTGGGGAGCATGGG - Intergenic
1067735852 10:48849700-48849722 ATGTTAACAATAGGGAAAACTGG - Intronic
1067846949 10:49732046-49732068 ATGTTATTATTGGAGAAAAATGG - Intergenic
1067985144 10:51135601-51135623 GTCTTATCATTGAGGAAAACTGG - Intronic
1068257462 10:54531856-54531878 TTGCTATCATAGCCGAAAACTGG + Intronic
1068593552 10:58875966-58875988 ATGATAACATGAGGGAAAACTGG + Intergenic
1068833780 10:61528700-61528722 ATGCTATCATTGGGGGGAAATGG + Intergenic
1070520005 10:77244380-77244402 TGGCTTTCATTGGGGAAATCAGG - Intronic
1071488449 10:86119448-86119470 AAGCTAAAAATGGGGAAAACTGG + Intronic
1071571130 10:86697938-86697960 ATGCTACCATTGGGAGAAGCTGG - Intronic
1071932652 10:90490264-90490286 ATGTTAACATTAGGGAAAACTGG - Intergenic
1072696092 10:97603939-97603961 ATGTTGCCATTGGGGAAAACTGG - Intronic
1072989569 10:100178986-100179008 ATGGTATTATTGGAAAAAACTGG - Intronic
1073283781 10:102374781-102374803 ATGTTACCATTGGGATAAACTGG + Intronic
1073376186 10:103036998-103037020 ATGTTACCATTGGGGGAAACTGG + Intronic
1073377336 10:103047565-103047587 ATGTTAACAATGGGGGAAACCGG + Intronic
1073813435 10:107177352-107177374 ATGTTACCATTGGGGGAAACTGG - Intergenic
1073980890 10:109152310-109152332 ATGTTACCATTGGGGAAAACTGG - Intergenic
1074149680 10:110747092-110747114 ATGTTATCATTGGGGAAGATAGG + Intronic
1074439450 10:113462582-113462604 ATGTTAGCATTGGGGAAAAGTGG - Intergenic
1074669853 10:115777776-115777798 ATGCAACCCTTGGGGAAAAAAGG + Intronic
1074916343 10:117959636-117959658 ATGTTACCATTGGAGGAAACTGG + Intergenic
1075095947 10:119471100-119471122 ATGCAAGCATTGGGGGAAACTGG + Intergenic
1075309631 10:121402633-121402655 ATGTTACCATTGAGGAAAATTGG + Intergenic
1076341288 10:129747566-129747588 ATGGTATAATTTGGGAAAATAGG - Intronic
1076666783 10:132097655-132097677 ATGTTCTCATTGGGGGAAATAGG + Intergenic
1077452511 11:2657547-2657569 ATGCTAACATTAGGGGAAGCTGG - Intronic
1078449559 11:11430304-11430326 ATGTTACCATTGGGGAATACTGG - Intronic
1078771045 11:14352047-14352069 ATGTTACCATTTGGGAAATCTGG + Intronic
1078792027 11:14553230-14553252 ATGTTACCATTGGGGGAAACAGG - Intronic
1078949685 11:16116581-16116603 ATGTTATCATTTGGGGAAACTGG - Intronic
1079152429 11:17912451-17912473 ATTCTATCATTGAGGGAAGCTGG + Intronic
1080022620 11:27578975-27578997 AAGCTATCATTGGGTGAAATTGG - Intergenic
1080613458 11:33925458-33925480 ATGCTAGCCTGGGGGAAAAAAGG - Intergenic
1080636284 11:34126583-34126605 ATGCTGGCATGGGGGTAAACTGG - Intronic
1080785550 11:35471963-35471985 ATGCCAGCATTAGGGAACACTGG + Intronic
1081443994 11:43111896-43111918 ATGTTATCATTGGGGGAAACTGG + Intergenic
1083066952 11:59934018-59934040 ATGTTACCATTGGGGAAAATTGG - Intergenic
1084017960 11:66397904-66397926 ATATTATCAATGGGGAAAACTGG - Intergenic
1084875615 11:72130452-72130474 ATGCCAACATTTGGGGAAACTGG + Intronic
1085493048 11:76939315-76939337 ATGTTAACAGTGGGGAAATCTGG + Intronic
1085665545 11:78412630-78412652 ATGTTACCATTAAGGAAAACTGG + Intronic
1086201563 11:84209525-84209547 ATGTTATCAATGTGAAAAACTGG + Intronic
1086470104 11:87099400-87099422 ATGCTACCATTGGGGGAAAATGG - Intronic
1086545295 11:87960841-87960863 ATGCTACAAATGGGCAAAACAGG - Intergenic
1087034802 11:93744561-93744583 ATGTTAACATTTGGGAAATCTGG + Intronic
1087141882 11:94772108-94772130 ATGTTACCAATGGGGGAAACTGG - Intronic
1087320112 11:96647641-96647663 ATGCTTTCATTGAGAAATACGGG - Intergenic
1087357556 11:97113879-97113901 ATTATATCATTGGAGAAAACGGG - Intergenic
1087448067 11:98280652-98280674 ATGTTACCATTGGGGGAAACAGG - Intergenic
1087744481 11:101927415-101927437 ATGTTATCATTGGGGGAAACTGG - Intronic
1087816888 11:102668390-102668412 ATGTAATCATTGGGGAAAACTGG - Intergenic
1088357386 11:108958167-108958189 ATGTTAACATTTGGAAAAACCGG - Intergenic
1088809688 11:113382980-113383002 ATGTTACCTTTGGGGGAAACTGG - Intronic
1088966842 11:114731865-114731887 ATGTTACCATTGGGGGAAACTGG + Intergenic
1089122976 11:116153283-116153305 ATATTATCATTGGGGGAAACTGG + Intergenic
1089441363 11:118520272-118520294 ATACTATCATTAAAGAAAACAGG - Intronic
1089571283 11:119412213-119412235 ATGTTGCCATTGGGGGAAACTGG - Intergenic
1089678065 11:120103696-120103718 ATGTTAATATTGGGGGAAACTGG + Intergenic
1089873679 11:121699334-121699356 ATCCTACCATTAGGAAAAACTGG - Intergenic
1090121689 11:124036151-124036173 CTGTTACCATTGGGGGAAACTGG + Intergenic
1090161869 11:124503774-124503796 ATGTTACCATTGGGAGAAACTGG + Intergenic
1090724014 11:129505787-129505809 ATGTTACCATTAGGGAAAACTGG - Intergenic
1091632516 12:2172788-2172810 ATGCCAAGATTGGAGAAAACTGG + Intronic
1092049790 12:5460115-5460137 ATGCTAATAATGGAGAAAACTGG - Intronic
1092302889 12:7269267-7269289 ATGTCAACAATGGGGAAAACTGG - Intergenic
1092495010 12:8984972-8984994 ATGCTAACATTAGGGGAAATGGG - Intronic
1092909768 12:13136450-13136472 ATGCTAAAATTGGGAGAAACTGG + Intronic
1092988388 12:13869858-13869880 ATGCTATCATCGGTGAAACCAGG + Intronic
1094286327 12:28798548-28798570 ATGCTTTCATTAGGAAAACCAGG + Intergenic
1095272615 12:40237586-40237608 ATGGTATCATTGATGAAGACAGG + Intronic
1095324727 12:40875261-40875283 ATGGTATCCCTGGGGCAAACTGG - Intronic
1095787915 12:46131086-46131108 ATATTACCATTGGTGAAAACTGG + Intergenic
1096189428 12:49605643-49605665 ATGATGTCACTGGGGAAAAGAGG - Intronic
1096438241 12:51614536-51614558 ATGCTAACATTAGGGGAAGCTGG - Intronic
1096708326 12:53437293-53437315 ATACTATCACTGGGGGAAGCTGG + Intergenic
1097660495 12:62425179-62425201 ATGAAACCATTGGGGTAAACTGG + Intergenic
1097825007 12:64166636-64166658 AAGCTATCATTAGAGCAAACAGG + Intergenic
1097857673 12:64482982-64483004 ATGCCACCATTGGGGGAAGCTGG + Intronic
1098177790 12:67810963-67810985 CTGCTTTCATGGAGGAAAACAGG + Intergenic
1098556816 12:71828182-71828204 ATGCTATCACTGGGAAAAACTGG - Intergenic
1098594080 12:72251036-72251058 ATGTTAGCATTGGGAGAAACTGG - Intronic
1099079018 12:78151787-78151809 ATATAATCATTGGGGGAAACTGG + Intronic
1099278675 12:80613195-80613217 ATATTACCAATGGGGAAAACTGG + Intronic
1099296949 12:80840222-80840244 ATGTTAATATTGGGGAAAGCTGG - Intronic
1099687558 12:85908990-85909012 AAGCTATCATCAGGGAGAACAGG + Intergenic
1099720195 12:86352463-86352485 ATGCTATCATTGTGAAAAGGAGG - Intronic
1100307948 12:93368456-93368478 TTGCTATCTTTTGGGAAAACAGG - Intergenic
1100443236 12:94637249-94637271 ATGCAATCATTGGGAGAAGCTGG + Intronic
1101167079 12:102049448-102049470 ATGCTATGGTTTGGGATAACAGG + Intronic
1101290966 12:103368674-103368696 ATGATATTATTGGTGAACACTGG + Intronic
1101549673 12:105750332-105750354 CTGCTATCATTGGGACACACAGG + Intergenic
1101869533 12:108553347-108553369 GTGTTATCATTGAGGGAAACTGG + Intronic
1102468687 12:113146377-113146399 ATGTTACCACTGGAGAAAACTGG + Intergenic
1103960823 12:124608199-124608221 ATGCTAACAGTAGGGTAAACTGG - Intergenic
1104408402 12:128537879-128537901 ATATTATCATTGGGGGAAGCTGG + Intronic
1105048033 12:133022561-133022583 ATGTTAGCATTGGGGGAAACTGG + Exonic
1105792219 13:23812708-23812730 ATGCTACCACTGGAGAAAACTGG + Intronic
1106205398 13:27588614-27588636 ATGCTACTATTGGGGGGAACTGG + Intronic
1106232950 13:27835978-27836000 ATGTTACCAATGGGGGAAACTGG - Intergenic
1106442178 13:29785253-29785275 ATGTTACCATTAGGGAAAACTGG + Intronic
1107134956 13:36933660-36933682 ATGCTACCACTGGGGGAAACTGG - Intergenic
1107151826 13:37120527-37120549 AAGATATCACTTGGGAAAACTGG - Intergenic
1107426280 13:40296274-40296296 ATGCCATCATGGGGGAAATGTGG + Intergenic
1108670053 13:52677280-52677302 ACACTATCAATGGGGGAAACTGG - Intronic
1110116073 13:71818239-71818261 ATGCTATAATTAGGGAAAACAGG + Intronic
1110186413 13:72680568-72680590 ATGTAAACATTGGGGGAAACTGG + Intergenic
1110310029 13:74038176-74038198 ATGCTACCAGTGGGGAAAACTGG + Intronic
1110634084 13:77745336-77745358 ATGTTACCACTGGGGGAAACTGG + Intronic
1110644775 13:77869601-77869623 ATGTTACCATTGGGGTAAACTGG - Intergenic
1111533953 13:89577107-89577129 AGGCTTTCATTGGAGAAAAGGGG - Intergenic
1111574965 13:90142013-90142035 ATGTTACCATTGGGGGAGACTGG + Intergenic
1112528183 13:100173141-100173163 AAGCTAGCAGTGGGAAAAACAGG + Intronic
1112905210 13:104409526-104409548 ATGCTATCATTTGGAGAAACTGG + Intergenic
1113154167 13:107298827-107298849 TTGTTATCATTAGGGAAAGCTGG - Intronic
1113862022 13:113492397-113492419 GTGCTACCATTGGAGAAAACAGG - Intronic
1114260465 14:21032907-21032929 ATGTAACCATTGGGGGAAACTGG - Exonic
1115076418 14:29397694-29397716 ATGTTATCATTGGAGAAAACTGG - Intergenic
1116895260 14:50310174-50310196 ATGTTTTCATTGGGGTAAATGGG + Intronic
1116969123 14:51046438-51046460 ATGCTACCACTGGGAGAAACTGG + Intronic
1117291290 14:54336199-54336221 ATGCTACCACTGAGGGAAACTGG + Intergenic
1117357763 14:54942369-54942391 ATGTTACCACTGGGGAAAACTGG - Intronic
1117531373 14:56663561-56663583 ATGTCATTATTGGGTAAAACTGG - Intronic
1117701812 14:58421482-58421504 ATGTTACCATTGTGGAAAACTGG + Intronic
1118114532 14:62760423-62760445 GTGCTATCATTAGGGGAAATCGG + Intronic
1118164704 14:63324901-63324923 ATGTTATCATTGAGGGAGACTGG + Intergenic
1118300264 14:64608877-64608899 ATGCTACCATTGGGAGAAACTGG - Intergenic
1118929609 14:70229230-70229252 AAACTATCATTAGAGAAAACAGG + Intergenic
1119170870 14:72535457-72535479 ATGTTGCCATTGGGGCAAACTGG - Intronic
1119664597 14:76475943-76475965 ATGTTACCATTAGGGGAAACTGG - Intronic
1119775677 14:77246960-77246982 GTGCTTCCATTGGGGGAAACTGG - Intronic
1119801528 14:77449492-77449514 ATGCTGTCTTTGGGGAAGAACGG - Intronic
1120965366 14:90162486-90162508 ATGTTGCCATTGAGGAAAACTGG + Intronic
1121260376 14:92561574-92561596 ATGTTAACAATGGGGGAAACTGG - Intronic
1121475970 14:94203072-94203094 ATGTTACTATAGGGGAAAACTGG - Intronic
1121710594 14:96036084-96036106 ATGTTATCATTGGGAGAAACTGG + Intergenic
1121861101 14:97319365-97319387 ATGTTACCACTGGGGAAAGCAGG + Intergenic
1122373630 14:101243432-101243454 ATGCTACTTTTGGGGGAAACTGG - Intergenic
1122473538 14:101989092-101989114 ATGTTAACATTGGAGAAAGCTGG + Intronic
1123797008 15:23782325-23782347 ATGTTAGTAATGGGGAAAACTGG - Intergenic
1124608590 15:31192236-31192258 ATGTGATTATTGGGGGAAACTGG + Intergenic
1124918677 15:34002066-34002088 ATGTTATCATTGGGGTAAACTGG - Intronic
1125460920 15:39905957-39905979 ATGCTACCACTGGGGGAAACTGG + Intronic
1125987562 15:44069787-44069809 ATGTTACCATAGGGAAAAACTGG + Intronic
1127109792 15:55656261-55656283 ATGCCATCCTTGGAGAAGACAGG - Intronic
1127421678 15:58812486-58812508 ATTTTCCCATTGGGGAAAACTGG - Intronic
1127487442 15:59432404-59432426 GTGCTGTCCTTGGGGAAGACAGG + Intronic
1128411928 15:67408122-67408144 ATGCTGTTATTGCGAAAAACTGG - Intronic
1128438082 15:67675568-67675590 ATGTTACCATTAGGGGAAACTGG + Intronic
1128574754 15:68765132-68765154 ATCTTACCATTGGGGGAAACTGG + Intergenic
1128981358 15:72189456-72189478 ATGTTACCATTGGGGGAAACTGG + Intronic
1129131101 15:73496709-73496731 ATGTTAACATTTGGGAAAGCTGG - Intronic
1129635974 15:77318279-77318301 ATGTTATGATTGGGGGTAACTGG + Intronic
1130141855 15:81233245-81233267 ATGTTACTTTTGGGGAAAACTGG - Intronic
1130142610 15:81241706-81241728 ATGTTACCATTGGGGGAAACTGG - Intronic
1131705414 15:94990321-94990343 ATGTTACCATTGGGGGAAACTGG + Intergenic
1131821105 15:96274525-96274547 ATGCTGTCTTTGGGGAAAGCCGG + Intergenic
1131896386 15:97035113-97035135 ATGTTACCACTGGGGGAAACTGG + Intergenic
1132077736 15:98836557-98836579 ATGCTAACGTTAGGGAAAACTGG - Intronic
1132296623 15:100739787-100739809 ATGTTACCATTGGAGAAAACAGG - Intergenic
1132411607 15:101582672-101582694 ATGCTACCACTGGGGGAAACTGG - Intergenic
1132420132 15:101658743-101658765 ATGTTACCATTGAGGAAAACTGG + Intronic
1132817631 16:1840493-1840515 ATGGTAACACTGGGGGAAACGGG + Intronic
1133487563 16:6234924-6234946 ATGTTTCCATTGGGGGAAACTGG + Intronic
1134139485 16:11705251-11705273 ATGTTAACAATGGGGGAAACTGG + Intronic
1134345375 16:13386219-13386241 ATGTTATCATTAGGAGAAACTGG + Intergenic
1134394258 16:13848562-13848584 ATGCTGTCACTGTGGAACACTGG - Intergenic
1134563357 16:15229813-15229835 ATGCTAACATTAGGGGGAACTGG + Intergenic
1134743688 16:16571059-16571081 ATGCTAACATTAGGGGGAACTGG - Intergenic
1134923883 16:18141442-18141464 ATGCTAACATTAGGGGGAACTGG + Intergenic
1135940950 16:26821418-26821440 ATATTACCATTGGGGAAAAGTGG + Intergenic
1137238587 16:46635633-46635655 ATGTTACCATTGGAGGAAACAGG + Intergenic
1137468446 16:48732666-48732688 ATGCCATCATTGGGAGAAACTGG - Intergenic
1137497520 16:48982183-48982205 ATGTTTTCATTGGGAGAAACTGG - Intergenic
1137949418 16:52768999-52769021 ATGCTAACATTAGGAAGAACAGG + Intergenic
1138401057 16:56744555-56744577 ATACTATATTTGGGAAAAACTGG - Intronic
1138639465 16:58372006-58372028 ATGTTACCATTGGGGGAAACTGG - Intronic
1138697948 16:58833251-58833273 ATAGTATAATTGGGGGAAACAGG - Intergenic
1138745478 16:59358315-59358337 AAGTTATCATTGGGGAAGAAGGG - Intergenic
1139765230 16:69223141-69223163 ATGTTAACATTCGGGGAAACTGG - Intronic
1140069698 16:71638690-71638712 ATATTATCATTGGAGAAAACTGG - Intronic
1140426545 16:74866105-74866127 ATGTTACCATTGGGGGAAACTGG - Intergenic
1140495116 16:75379727-75379749 ATGGTACCATAGGGGGAAACTGG + Intronic
1142678068 17:1527781-1527803 ATGTTACCATTGGCAAAAACTGG + Intronic
1144095369 17:11895551-11895573 ATGTTACCATTGTGGAAAACTGG - Intronic
1146501221 17:33366112-33366134 ATGCTATGAGTGGGGACAAAAGG + Intronic
1147630749 17:41929749-41929771 ATGTTACCATTGGGAGAAACTGG - Intronic
1147814587 17:43199722-43199744 ATGCAGTCATGGGAGAAAACTGG - Intronic
1147901252 17:43786445-43786467 ATGCTAACATTGGTGGAGACTGG - Exonic
1147901359 17:43787514-43787536 ATGCTACCACTGGGGGAATCTGG + Exonic
1147908695 17:43841302-43841324 ATGCTAACATTAGAGAAAACAGG - Intergenic
1148039119 17:44692209-44692231 ATGTTACTATTGGGGGAAACTGG - Intergenic
1148407701 17:47432901-47432923 ATGCTAACATTAGGGGAAGCTGG - Intronic
1148534959 17:48430975-48430997 ATGTTACCCTTGGGGGAAACTGG + Intergenic
1149118183 17:53125395-53125417 ATGTTAATATTTGGGAAAACTGG + Intergenic
1149186263 17:54001332-54001354 GTGCCCTCATTGGGGAAAACTGG - Intergenic
1149636215 17:58172046-58172068 ATGCCATCATAGAGGAAAATTGG + Intergenic
1150137078 17:62701970-62701992 ATGCTGTCTTTGGGGGAAGCTGG - Intronic
1150346674 17:64410076-64410098 ATGTTACCATTAGGGGAAACTGG + Intronic
1151276769 17:73040575-73040597 ATGTTCACATTGGGGGAAACTGG + Intronic
1151810492 17:76437767-76437789 ATGTGAACATTAGGGAAAACTGG + Intronic
1152620121 17:81359189-81359211 ATGTTACCATTGGGGGAAATGGG - Intergenic
1153025427 18:668043-668065 ATATTATCACTGGGGGAAACTGG - Intronic
1154115728 18:11611677-11611699 ATGTTACCATTGATGAAAACTGG + Intergenic
1154120172 18:11645896-11645918 ATGTTACCATTGATGAAAACTGG + Intergenic
1154143575 18:11847527-11847549 ATGCTATCATTTGGCACATCTGG - Intronic
1154508923 18:15073475-15073497 TTGATTTCATTGGGGAAAATTGG + Intergenic
1155862176 18:30915890-30915912 ATGTTACCATTGGAGGAAACAGG + Intergenic
1156092759 18:33491309-33491331 TTATTATCATTGGGGGAAACTGG + Intergenic
1156118414 18:33815155-33815177 ATACTAACATTAGAGAAAACTGG - Intergenic
1156310126 18:35914478-35914500 ATGTTACCATTGGGGAAACTGGG - Intergenic
1156908607 18:42384108-42384130 ATGTTAACATTTGGGAAATCTGG - Intergenic
1157445314 18:47741383-47741405 ATGCCATCATGGGGGATAGCAGG - Intergenic
1157907162 18:51579414-51579436 ATGTTACCATTGGAGAAAATGGG - Intergenic
1157994002 18:52533137-52533159 ATGATACCATTGGGGGAAACAGG - Intronic
1158344569 18:56503130-56503152 ATGTTACCATTGGGGGAGACTGG + Intergenic
1159436624 18:68426225-68426247 ATGATATCCCTGGGGAAAAATGG - Intergenic
1159527509 18:69612057-69612079 ATGTTACCACTGGGGGAAACTGG + Intronic
1159532561 18:69672780-69672802 ATGCTTTCATTCTTGAAAACTGG - Intronic
1159929861 18:74299336-74299358 ATGTAACCATTGGGGGAAACTGG - Intergenic
1160082956 18:75747218-75747240 ATGTTTCTATTGGGGAAAACTGG - Intergenic
1161141113 19:2648435-2648457 ATGCTAACATAAGGGAAAACTGG + Intronic
1161387481 19:4003770-4003792 ATACTATCACTGGGGAAAGCTGG + Intergenic
1161930586 19:7336916-7336938 ATGCTGTCATTCAGGAAGACAGG - Intergenic
1163140298 19:15343354-15343376 ATGCTGAGATTGGGGAAAATGGG - Intergenic
1164790045 19:30969645-30969667 ATGTTACTGTTGGGGAAAACTGG + Intergenic
1164863691 19:31584874-31584896 ATGCTAACATTAGAAAAAACAGG - Intergenic
1164936124 19:32215381-32215403 GTGTTACCATTGGGGGAAACTGG + Intergenic
1165637177 19:37350474-37350496 ATATTATCATTGGGGAAAGCAGG - Intronic
1165896900 19:39146983-39147005 GTGTTACCATTGGGGAAAACTGG - Intronic
1165915135 19:39253957-39253979 ATGTTACCATTGGGGGAAACTGG + Intergenic
1165915626 19:39257397-39257419 ATATTACCATTGGGGGAAACTGG - Intergenic
1166616625 19:44254327-44254349 ATTCTATCATGGTGGAAAAGTGG + Intronic
1166650046 19:44566348-44566370 ATGTATTCATTGGGGGAAACTGG + Intergenic
1168212706 19:54902264-54902286 ATGCTAACTTTGGGGAAATCTGG + Intergenic
925357868 2:3254936-3254958 GTGTTACTATTGGGGAAAACTGG + Intronic
927045952 2:19278525-19278547 AAACTATCATTGGAGTAAACAGG - Intergenic
927082572 2:19644982-19645004 ATGTTAACATTAGGGGAAACTGG + Intergenic
927145052 2:20158812-20158834 ATGTTACCATTGGGGGAAACCGG - Intergenic
927690644 2:25205661-25205683 ATGTTACCATTGGGGAAAACTGG - Intergenic
927801937 2:26108707-26108729 ATGTTATCATTAGGAAAAGCTGG + Intronic
928032510 2:27793914-27793936 ATGCTAATATTGGGGAAACTAGG + Intronic
928055380 2:28048276-28048298 ATTCTATTAGTGGGCAAAACAGG - Intronic
928549283 2:32356155-32356177 ATGCAACCATTGGGGGAAACTGG + Intergenic
928886727 2:36157590-36157612 ATACAATCTTTGGGGGAAACTGG + Intergenic
929090608 2:38213563-38213585 ATGTTACCATTGGGAGAAACTGG + Intergenic
929298645 2:40276140-40276162 GGGCAATCATTTGGGAAAACTGG + Intronic
929547677 2:42866385-42866407 CTGCTCCCATGGGGGAAAACAGG - Intergenic
930297417 2:49572291-49572313 AAGCTCTTCTTGGGGAAAACTGG - Intergenic
931881191 2:66573180-66573202 ATGTTCTCATTGGATAAAACTGG + Exonic
931977794 2:67662407-67662429 ATGTTAACATTAGGGGAAACTGG - Intergenic
932176253 2:69605511-69605533 ATGTCACCATTGGGGGAAACTGG - Intronic
932214363 2:69957340-69957362 ATGCTAATATTTGGGGAAACTGG + Intergenic
932315863 2:70781980-70782002 ATGCAACCATTGCGGAAAACTGG + Intronic
933157893 2:78994274-78994296 CTAGTATCTTTGGGGAAAACTGG - Intergenic
933884678 2:86707121-86707143 ATGTTATCATTGGGGGAAACTGG - Intronic
933982043 2:87558478-87558500 ATGTTATCTTTAGGGGAAACTGG - Intergenic
934035568 2:88086175-88086197 ATGTTACCATTGGAGAAAACTGG + Intronic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
935468098 2:103423501-103423523 ATGCTATTTTTGGGGAAAAAAGG + Intergenic
935634637 2:105240769-105240791 ATGTTACCATTAGGGAAAACTGG + Intergenic
935658226 2:105443079-105443101 ATGGTATCATAGGGGAAAGGTGG + Intergenic
936273035 2:111066520-111066542 ATGTTACCATTGGGCGAAACTGG + Intronic
936311794 2:111392334-111392356 ATGTTATCTTTAGGGGAAACTGG + Intergenic
936377636 2:111955672-111955694 ATCTTATCATTGGGTAAAGCTGG + Intronic
936742397 2:115529015-115529037 ATAGTATCGGTGGGGAAAACTGG + Intronic
937130362 2:119506991-119507013 ATGTTACCATTGGGAGAAACTGG + Intronic
937576412 2:123427695-123427717 ATGATACCATTGGGGGGAACTGG + Intergenic
937816303 2:126254408-126254430 ATTCTACTATTGAGGAAAACTGG - Intergenic
938004955 2:127781546-127781568 TTGTTATCATTGGGAGAAACTGG + Intronic
939318922 2:140589985-140590007 ATGTAATCATTAGGGAAAACTGG + Intronic
939624446 2:144459873-144459895 ATTCTCTCATAGAGGAAAACAGG + Intronic
939842695 2:147207779-147207801 TTGCTATCACTGTGGAAGACAGG + Intergenic
939901986 2:147861747-147861769 GTGCTCTCATTCGGGAATACAGG - Intronic
939941098 2:148352379-148352401 ATACTACCATTGGGGGAAATTGG - Intronic
940861864 2:158779018-158779040 ATGTTACCATTGGGTGAAACTGG + Intergenic
940878064 2:158918259-158918281 ATGTCATCATTGGGGGTAACTGG + Intergenic
940914915 2:159243516-159243538 ATGTTACCAGTGGGGAAAGCTGG + Intronic
940969578 2:159881027-159881049 ATATTATCATTAGGTAAAACAGG + Intronic
941008136 2:160268651-160268673 ATGTTTTCATTGTTGAAAACTGG + Intronic
941036403 2:160573744-160573766 ATGTTACCATTGGGGAAAACTGG + Intergenic
941211188 2:162641801-162641823 ATGTTATCATTGGTGGAAATGGG + Intronic
942175135 2:173326044-173326066 ATGTTACCACTGGGGAAAACTGG - Intergenic
942209997 2:173660598-173660620 AGGCTGACATTGGGGAAACCTGG + Intergenic
942284665 2:174403830-174403852 ATGTTACCATTGGGGGAAACTGG + Intronic
942497516 2:176555302-176555324 ATGTTACCATTGTGGGAAACTGG - Intergenic
942823686 2:180147658-180147680 ATGTTATTATTGGAGGAAACTGG - Intergenic
943068424 2:183113489-183113511 ATGTAATCATTGGGAGAAACTGG + Intergenic
943101576 2:183493152-183493174 ATTCCACCATTGGGGAAAAAGGG + Intergenic
943450952 2:188041325-188041347 ATGTTACTATTGGGGAAAACTGG + Intergenic
943565513 2:189511130-189511152 ATGCTACCATTTGGGAAACTGGG + Intergenic
943600601 2:189916174-189916196 ATGTTACCATTGAGGAGAACTGG - Intronic
943644899 2:190399722-190399744 ATGCTAACACTGGGGAAAGCTGG + Intergenic
944380427 2:199103099-199103121 AAGTTAGCATTGGGGGAAACTGG - Intergenic
945326089 2:208484414-208484436 ATGCCACCATTGAGGGAAACTGG - Intronic
946426440 2:219600438-219600460 ATGTAACCATTAGGGAAAACTGG + Intronic
946508032 2:220322490-220322512 ATGTTACCACTGGGGGAAACTGG - Intergenic
946890083 2:224266137-224266159 ATGCTAACATTGAGGAAAGTTGG + Intergenic
947295083 2:228621827-228621849 ATGTTACCACTGGGGGAAACTGG + Intergenic
947366513 2:229401733-229401755 ATGTTATCATTGGAGGAAACTGG + Intronic
947550932 2:231046175-231046197 ATGTTACCATTGGGGGAAACTGG - Intronic
947967414 2:234293024-234293046 GTGTTATCACTGGGGGAAACTGG - Intergenic
948224355 2:236297601-236297623 ATGTTACCATTGGGGGAAACTGG + Intergenic
948500786 2:238392255-238392277 ATGTTATCACTGGGGGAAAGTGG - Intronic
1168755805 20:316805-316827 AGGAATTCATTGGGGAAAACAGG + Intergenic
1169246461 20:4028937-4028959 ATGTTACCATTGGGGGAAACTGG - Intergenic
1169470001 20:5876973-5876995 ATGATATCATTGAAGGAAACTGG + Intergenic
1169743269 20:8918120-8918142 ATCCTATCCATGGGGAAAATGGG - Intronic
1169771426 20:9205535-9205557 ATATTACCAGTGGGGAAAACTGG - Intronic
1170197800 20:13707979-13708001 ATACTACCATTGAGGGAAACTGG - Intergenic
1170708009 20:18763361-18763383 GTGTTATCATTGGGCAGAACTGG + Exonic
1171074468 20:22108607-22108629 ATGTTACCATTGGAGGAAACTGG - Intergenic
1171267016 20:23779887-23779909 AAACTATCATTGGAGTAAACAGG - Intergenic
1172052679 20:32130910-32130932 ATGTTAGCATTAGGGGAAACTGG + Intronic
1172066709 20:32226323-32226345 ATGTTACCATTGGGGGAAATTGG - Intronic
1172965752 20:38833495-38833517 ATGCTACCACTGGGATAAACTGG + Intronic
1173038465 20:39435692-39435714 ATGCTATCATTGAGGAAACTGGG - Intergenic
1173045857 20:39511100-39511122 ATGTTATCATTGGGGGAAACTGG - Intergenic
1173343133 20:42172614-42172636 GTGTTAACATTGGGGAAAACTGG - Intronic
1173686775 20:44929473-44929495 ATGTTCACATTGGGGGAAACTGG + Intronic
1173887759 20:46476491-46476513 ATGTTACCATTAGGCAAAACTGG + Intergenic
1174298610 20:49566932-49566954 ATGTTAACAATAGGGAAAACGGG + Intronic
1174411165 20:50337378-50337400 CTGTTAACATTGGGGGAAACTGG + Intergenic
1174485752 20:50860168-50860190 ATGTTACCACTGGGGACAACTGG - Intronic
1174609392 20:51786695-51786717 GTGCTACCAATGGGGAAAACTGG + Intronic
1174731035 20:52917928-52917950 GTGCTATCACTGGAGAAAAGGGG - Intergenic
1174758989 20:53187821-53187843 GTGCTATCATGAGGGAAAATGGG + Intronic
1174926084 20:54761556-54761578 ATACTACTATTGTGGAAAACTGG + Intergenic
1174955973 20:55099108-55099130 ATGTTACCACTGGGGGAAACTGG - Intergenic
1174976001 20:55335039-55335061 ATGCTATCATTTGGGGAAGCTGG - Intergenic
1175059947 20:56232886-56232908 ATGTTAACAATGGGGAAAATAGG + Intergenic
1175203177 20:57291870-57291892 ATGCTAACATTAGGGGAAGCCGG - Intergenic
1175280785 20:57802895-57802917 ATGTTACCACTGGGGGAAACGGG - Intergenic
1175646818 20:60681520-60681542 ATATTATAATTGGGGGAAACTGG - Intergenic
1175656747 20:60777424-60777446 ATGTTACCATTGGGAGAAACTGG - Intergenic
1175970056 20:62681271-62681293 ATGTTACCATTGGGGGAGACTGG - Intronic
1176360320 21:5989800-5989822 ATGCTAACATTAGGGGAAGCTGG - Intergenic
1176789150 21:13298265-13298287 TTGATTTCATTGGGGAAAATTGG - Intergenic
1177280803 21:18980780-18980802 ATGCTAAAAATGGGAAAAACCGG + Intergenic
1177438229 21:21083805-21083827 ATGCTGTCATTGGGAGAAACTGG - Intronic
1177824177 21:26064317-26064339 ATGTTAACAATAGGGAAAACTGG + Intronic
1178369220 21:32013229-32013251 ATGCTAACAATGGGAGAAACTGG - Intronic
1178735918 21:35150761-35150783 ATGTTATCATTAGGGGAAGCTGG + Intronic
1178790597 21:35696253-35696275 ATGATATCATTGGGGGACCCTGG + Intronic
1179534150 21:42040451-42040473 AAGCTACCATCGTGGAAAACAGG - Intergenic
1179763198 21:43548750-43548772 ATGCTAACATTAGGGGAAGCTGG + Intronic
1180164370 21:46014999-46015021 ATGCTAACGTTGGGGGAAACTGG - Intergenic
1180355105 22:11832936-11832958 ATGATATAATTGGGTAGAACTGG + Intergenic
1180383146 22:12159395-12159417 ATGATATAATTGGGTAGAACTGG - Intergenic
1180906766 22:19418829-19418851 ATGTTAACATTGGGAGAAACTGG + Intronic
1180947186 22:19702648-19702670 ATGGCATCATTGGGGAAAACTGG + Intergenic
1181103357 22:20556194-20556216 ATACTATTATTGGGGAGAGCTGG - Intronic
1181104235 22:20563691-20563713 ATGTTACCATTGGAGGAAACTGG + Intronic
1181309305 22:21935470-21935492 ATGTTACCATTGGAGGAAACTGG + Intronic
1181611223 22:24013575-24013597 ATGTTAACATTAGGGAAAGCAGG - Intronic
1181763549 22:25075024-25075046 ATGCTAACATTAGGGGAACCGGG - Intronic
1182574760 22:31265811-31265833 ATGTTATTATTGGGGAACAGGGG - Intronic
1182912539 22:33997507-33997529 ATTCTATCATGACGGAAAACAGG - Intergenic
1183019493 22:35015859-35015881 ATGTTAACAATGGGGAAAACGGG + Intergenic
1183031063 22:35104863-35104885 ATCTTACCATTGGAGAAAACTGG - Intergenic
1183670869 22:39271879-39271901 ATGTTAACATTAGGGGAAACTGG - Intergenic
1183838597 22:40478374-40478396 ATGCTAACATTAGGGGCAACTGG + Intronic
1184624330 22:45711600-45711622 ATGTTACCATTGGGGAAAACTGG + Intronic
1184701303 22:46175211-46175233 ATGTTACCCTTGGGGAAAACTGG - Intronic
949248084 3:1948745-1948767 ATGCTACTAGTGGGGAAAATAGG + Intergenic
949347691 3:3091847-3091869 ATGTTACCCTTGAGGAAAACTGG + Intronic
949469975 3:4384334-4384356 ATGTTGCCATTGGGGAAAACTGG - Intronic
949475962 3:4445853-4445875 ATGGTACCATTGGAGGAAACTGG + Intronic
950211783 3:11128848-11128870 ATGTTAGCACTGGGGAAAAATGG + Intergenic
950413089 3:12851729-12851751 CTGTTACCATTGGGGGAAACTGG + Intronic
950472623 3:13195913-13195935 ATGTTACCATTGGAGGAAACTGG + Intergenic
951055977 3:18146699-18146721 ATGCCATTAATGGGGAACACTGG + Intronic
951553661 3:23899302-23899324 ATGGTACCACTGGGGCAAACTGG + Intronic
952208707 3:31206737-31206759 AAGTTATCACTGGGGAAAACTGG - Intergenic
952724096 3:36563912-36563934 ATGTTACCACTGGGGGAAACTGG - Intergenic
952804537 3:37335690-37335712 ATGCAATGATTTGGGAAAATTGG + Intronic
952831185 3:37566439-37566461 ATGTTATCATTGGGAAAAGCCGG - Intronic
953267006 3:41400117-41400139 ATGCTTCCATTGGGGAAACTGGG - Intronic
953282001 3:41567908-41567930 ATGTTAACATGAGGGAAAACTGG - Intronic
953435224 3:42872475-42872497 ATGGTTTCATTGGAGAAAGCTGG + Exonic
953464611 3:43108416-43108438 ATGTAACCATTGGGGGAAACTGG + Intergenic
953487312 3:43313763-43313785 ATGTTACTATTGGGGGAAACTGG + Intronic
953728547 3:45424009-45424031 ATGTTATCATTGGGCAAAGCTGG - Intronic
953854029 3:46486967-46486989 ATGGTAACAATGGGGGAAACTGG - Intergenic
954965651 3:54608250-54608272 ATGTTATCATTGGGGGAAGCTGG + Intronic
955024151 3:55151148-55151170 ATGTTATCACTGGGGAAAACTGG - Intergenic
955044334 3:55345693-55345715 ATGTAATCACTGGGGGAAACTGG + Intergenic
955633626 3:61001906-61001928 ATATTAACATTGGGGAAAACTGG + Intronic
955722322 3:61895945-61895967 ATGCTACCTTTGGGGAAACTAGG - Intronic
955814369 3:62826415-62826437 ATGTTATTGTTGGGGAAAAATGG + Intronic
955846271 3:63166422-63166444 ATGTTACCATTAGGGAAAACCGG - Intergenic
956140425 3:66141171-66141193 TTGTTAGCATTGGGGGAAACAGG + Intronic
956214370 3:66833236-66833258 ATGTCAGCATTGGGGGAAACTGG - Intergenic
956602976 3:71042903-71042925 ATGCTAGCATTGGAGAGCACTGG + Intronic
956633769 3:71342813-71342835 ATGTCACCGTTGGGGAAAACTGG - Intronic
957356111 3:79089275-79089297 ATGCTAACAATGGGGACCACTGG - Intronic
958858487 3:99416588-99416610 ATGTTAACATTGGGGAAAACTGG + Intergenic
958919942 3:100093561-100093583 ATGTTACCATTGGAGGAAACTGG - Intronic
958958764 3:100489299-100489321 ATGTTACCATTGGGGGAAACTGG - Intergenic
958978506 3:100693735-100693757 ATATTATCATTTGGGAAAGCTGG - Intronic
959575701 3:107930970-107930992 ATGCTGTGAGTGGGTAAAACAGG + Intergenic
959923597 3:111896958-111896980 ATGTTACCATTGGAGGAAACTGG - Intronic
960444436 3:117730394-117730416 ATACTATCATTGGGGAAAGTTGG - Intergenic
960517447 3:118617901-118617923 ATACTAACATTAGGGAAAACTGG - Intergenic
960942106 3:122941825-122941847 ATGTTAGCCTTGGGGGAAACTGG + Intronic
961421666 3:126810676-126810698 ATGTTAACATTAGGGGAAACTGG + Intronic
961444724 3:126973990-126974012 ATGTGACCATTGGGGGAAACTGG - Intergenic
962073961 3:132061005-132061027 AAGCTATCAATGGAGTAAACAGG - Intronic
962121881 3:132569941-132569963 ATGTTACCATTGGGGAAACTGGG + Intronic
962124528 3:132601857-132601879 ATGGAACCATTGGGGAAAACTGG + Exonic
963667612 3:148208740-148208762 ATGATATCGCTGGGGGAAACTGG + Intergenic
963954754 3:151241719-151241741 ATGCTTTCTTTGTGGAATACTGG + Intronic
964166203 3:153708687-153708709 ATATTATTATTGGAGAAAACTGG - Intergenic
964171546 3:153775977-153775999 ATGTTACTATTGTGGAAAACTGG - Intergenic
964483245 3:157162418-157162440 ATATTATCATTGGGGAAAGTTGG + Intergenic
965063813 3:163817500-163817522 ATGTTACCATTGGAGCAAACAGG - Intergenic
965660064 3:171031512-171031534 ATGTTACCATTGGAGAAAATTGG - Intergenic
966831342 3:184012144-184012166 ATGTTACCACTGGGGGAAACTGG + Intronic
967184481 3:186932848-186932870 ATGTTAACTTTGGGGAAATCCGG - Intronic
967761380 3:193229693-193229715 ATGCTACCAATGGTGACAACTGG + Intergenic
967919630 3:194604685-194604707 GTGCTATCATTTTGGAAATCGGG - Intronic
969076218 4:4579858-4579880 ATGCTCCCTTTGGAGAAAACTGG - Intergenic
970536452 4:17035024-17035046 ATGCTGTTATTGGGGGAAGCTGG - Intergenic
970750845 4:19358609-19358631 ATGTTACCATTGGGGGAAACTGG + Intergenic
970822714 4:20237648-20237670 AAGTAACCATTGGGGAAAACTGG - Intergenic
970822922 4:20240145-20240167 AAGTAACCATTGGGGAAAACTGG - Intergenic
971378163 4:26072208-26072230 ATGTTAACATTGGGGGAATCTGG + Intergenic
971931480 4:33089635-33089657 ATCCTATGAATGGGGAAGACTGG - Intergenic
971945156 4:33265925-33265947 ATCCTATCAGTGGGGAAGTCTGG - Intergenic
972833191 4:42837387-42837409 ATGCCATCATTGAGGGAAGCTGG + Intergenic
973373062 4:49267712-49267734 ATGATATAATTGGGTAGAACTGG - Intergenic
973387939 4:49527369-49527391 ATGATATAATTGGGTAGAACTGG + Intergenic
974941889 4:68479106-68479128 ATGTAATCATTGGAGAAAACTGG - Intronic
975044748 4:69787611-69787633 ATGTTACCACTGGAGAAAACTGG - Intronic
975223466 4:71841185-71841207 TTGCTAACATTGGAGAAAACTGG - Intergenic
975225699 4:71869351-71869373 ATGTTACCATTGGGAAAAACTGG - Intergenic
975974982 4:80084659-80084681 ATGTTACCACGGGGGAAAACTGG + Intronic
976459036 4:85286281-85286303 ATGCTTTCATGGGGGAAACATGG - Intergenic
976616305 4:87081070-87081092 ATGCTAACATTTGGGAAATCTGG + Intronic
976627214 4:87198934-87198956 TTGTTATCATTGAGGGAAACTGG + Intronic
976662888 4:87558675-87558697 ATGTTACCTTTGGGGGAAACTGG + Intergenic
976665097 4:87582020-87582042 ATGTTACCACTGGGGGAAACTGG + Intergenic
976848451 4:89516977-89516999 ATGTTAGCATTAGGGGAAACTGG - Intergenic
976943264 4:90732838-90732860 ATGCTATCATTTGTAACAACAGG - Intronic
977407853 4:96622623-96622645 ATGTTACCATTAGGGAAATCAGG - Intergenic
977421057 4:96800178-96800200 ATGTTATCATTGGAGGAAACTGG + Intergenic
977860379 4:101951168-101951190 ATGCTAATAATGGGGGAAACTGG + Intronic
977916923 4:102604385-102604407 ATGTTACCATTGGGGGAAACTGG - Intronic
977973472 4:103237684-103237706 ATGTTATCATTGGGAGAAACTGG + Intergenic
977986793 4:103391934-103391956 ATGTTATCATTGGGAGAAACTGG - Intergenic
978407005 4:108390694-108390716 ACGTTACCATTGGGGGAAACTGG + Intergenic
980128391 4:128795207-128795229 ATGTTACTATTGGGGGAAACAGG - Intergenic
981543534 4:145871201-145871223 ATGCTAACATTAGGGAATTCTGG - Intronic
981552423 4:145955513-145955535 ATTCTTTCATTAGGGAAAAAGGG - Intergenic
981858805 4:149329222-149329244 ATGTTACCATTGTGAAAAACTGG - Intergenic
982212759 4:153052873-153052895 ATGTTAACATTTTGGAAAACTGG - Intergenic
982554870 4:156847671-156847693 ATGCTAACATTGGAGGAACCTGG + Intronic
982596907 4:157397003-157397025 CTATTATCATTGGGGAAAACTGG + Intergenic
983184605 4:164687740-164687762 ATGTTATTGTTGGGGAAAATTGG - Intergenic
983568002 4:169175024-169175046 TTACCAACATTGGGGAAAACTGG - Intronic
983584961 4:169344603-169344625 ATGTTACCATTGGGGAAAACTGG - Intergenic
983745661 4:171196333-171196355 ATGTTAACATTTGGGGAAACTGG - Intergenic
983767727 4:171506800-171506822 ATGTTAGCAGTGGGGAAAGCTGG - Intergenic
984233006 4:177121931-177121953 ATGTAACCATTGGGCAAAACGGG + Intergenic
984460215 4:180025942-180025964 ATGTTACCAATGGGGAAACCAGG + Intergenic
984571054 4:181394371-181394393 ATTCTAGCATTGGGAAACACAGG + Intergenic
985362923 4:189194406-189194428 AGGATATCACTGGGGAAAACCGG - Intergenic
985496989 5:214289-214311 ATGCTTCCACTGGGGAAAGCTGG + Intronic
986004936 5:3659741-3659763 ATGTTATCATTGAGGGAAACTGG - Intergenic
986723316 5:10576091-10576113 ATGCTACCTTTGGGGAGGACAGG + Intronic
986946852 5:13031569-13031591 ATGATATCATTGAGGGTAACGGG + Intergenic
987520571 5:18977288-18977310 ATACTTTCCTTGGGGTAAACTGG + Intergenic
988389404 5:30607917-30607939 ATTGTATGATTGGGGAAAAGGGG + Intergenic
988612758 5:32743277-32743299 ATGTTACCATTGCGGGAAACTGG - Intronic
988661296 5:33272146-33272168 ATGCTATCATTGGGGGAAGTTGG + Intergenic
990218330 5:53559523-53559545 ATGTAATCACTGGGGGAAACAGG + Intergenic
990319215 5:54613142-54613164 ATGCCATAATTGGGAAATACTGG + Intergenic
990696606 5:58425125-58425147 ATGTTACCATTGGGGGAAGCTGG - Intergenic
991083468 5:62625981-62626003 ATGTTAACATTAGGAAAAACTGG - Intronic
991452599 5:66768770-66768792 ATGTTACCATTGGGGAAACTGGG + Intronic
991952925 5:71964246-71964268 ATGTAACCATTGGGGGAAACTGG + Intergenic
992373071 5:76165219-76165241 ATATTATCATTGGGGGAAGCTGG - Intronic
992981796 5:82182848-82182870 ATGTTACCATTGGGGGAAACTGG + Intronic
992989152 5:82266091-82266113 ATACTATCATTTGGGAAAGCTGG - Intronic
992996686 5:82340749-82340771 TTCCTGTCATTGAGGAAAACAGG + Intronic
993249485 5:85500090-85500112 ATGCTATTACTGGGGAAAATTGG + Intergenic
993943049 5:94084748-94084770 ATCATATCACTGGGGAAAACAGG + Intronic
994043987 5:95287196-95287218 ATAATATCATTGGGGGAAATTGG + Intergenic
994164922 5:96598408-96598430 ATCCAAGCACTGGGGAAAACTGG + Intronic
994323249 5:98417924-98417946 ACGTTATCATTGGGTAAAGCTGG + Intergenic
994551654 5:101241440-101241462 ATGTTATCACTGGGGCAAGCAGG - Intergenic
995025956 5:107422822-107422844 GTGCCATGAGTGGGGAAAACAGG + Intronic
995516732 5:112961776-112961798 ATGTTACCATTGCGGAAAACTGG + Intergenic
995918890 5:117286903-117286925 TTGCTATCTTTGGTGTAAACTGG - Intergenic
996437199 5:123447790-123447812 TTGCTATCATTGGGAGAAGCTGG - Intergenic
996869493 5:128172279-128172301 ATGTTATCATTGGGGGAAACTGG - Intronic
997275861 5:132588551-132588573 ATGTTATCATTGGGAGAAACTGG + Intronic
997342562 5:133156475-133156497 ATGTAACCATTGGGGAAAATTGG - Intergenic
997676762 5:135719058-135719080 ATGTTATCACTGAGGAAAACTGG + Intergenic
998277509 5:140770746-140770768 ATGTTACCATTGTGGAAAAGTGG - Intergenic
998293005 5:140934966-140934988 GTGTTATCACTGGGGAAAAGTGG - Intronic
998474759 5:142411291-142411313 AAGATATCATTGGGGGAAGCTGG - Intergenic
998835442 5:146198554-146198576 ATGCTGCCATTGGAGGAAACTGG - Intergenic
999080713 5:148840902-148840924 ATGCTAACATTCAGGGAAACAGG + Intergenic
999099283 5:149009229-149009251 TTCCTATAATTGGGGAAACCTGG + Intronic
999583944 5:153069999-153070021 ATTTTATCACTGGGGAAAACTGG - Intergenic
999674440 5:153984772-153984794 CTGTTATCATTGGGGGAAACTGG - Intergenic
999978116 5:156932609-156932631 ATGTGATCATTGGGGGACACTGG + Intronic
1000559821 5:162771860-162771882 ATGTTACCATTGAGAAAAACTGG - Intergenic
1000560659 5:162784327-162784349 ATGCTATCAATGGTGTAAAGAGG - Intergenic
1000992645 5:167926857-167926879 ATGCTAGCTTTGGGGGAAACTGG + Intronic
1001294673 5:170490580-170490602 ATGTTACCACTGGGGGAAACTGG + Intronic
1002830644 6:817371-817393 ATGTTACCACTGGGGGAAACTGG - Intergenic
1002912789 6:1503481-1503503 ATGCTAACATTAGGGGAAGCTGG + Intergenic
1003085169 6:3054663-3054685 ATGCCACCATTGGGGGAAACCGG + Intergenic
1003166420 6:3682859-3682881 ATGTTAACATTGGGAGAAACTGG - Intergenic
1003907000 6:10710736-10710758 ATGTTATCATTGGGAAAACCGGG - Intergenic
1004018706 6:11756488-11756510 ATGTTACCATTGGGGGAAACTGG + Intronic
1004333879 6:14746331-14746353 ATGTGATCATTGGGGGAAACTGG + Intergenic
1004579094 6:16930421-16930443 GTGTTACCATTGGGGGAAACTGG + Intergenic
1004907166 6:20247200-20247222 AGGTTATCATTGGGGGAAACTGG + Intergenic
1004971557 6:20916287-20916309 ATGATATCATTCGGGGAACCTGG + Intronic
1006214437 6:32428119-32428141 ATGTAACCATTGGGGGAAACTGG - Intergenic
1006241332 6:32681818-32681840 ATGTGACAATTGGGGAAAACTGG + Intergenic
1006249480 6:32769254-32769276 ATGTTACAATTGGGGAAAACTGG + Intergenic
1006252686 6:32802394-32802416 ATGTTATCCTTGGGGGAAACTGG - Intergenic
1006392563 6:33767128-33767150 ATATTATCATTGGGGGAAGCTGG + Intergenic
1006976322 6:38105688-38105710 ATGTTACCCTTGGGGAAAACTGG + Intronic
1007145719 6:39628124-39628146 ATGTTACAATTGGGAAAAACTGG - Intronic
1007244365 6:40449773-40449795 ATGTTACCAATGGGGAAAATGGG - Intronic
1008004628 6:46397516-46397538 ATGCTACCTTTGGGGGAAGCTGG + Intronic
1008044357 6:46836512-46836534 ATGCTAACATTAGGGAAAGCTGG - Intronic
1008625566 6:53312639-53312661 ATGTTACCACTGGGGGAAACAGG + Intronic
1008677977 6:53841933-53841955 ATGTTACCATTGGGAAAAACTGG - Intronic
1008695052 6:54025934-54025956 ATGCTATCTCTGGAGAAAAGTGG - Intronic
1009168788 6:60373315-60373337 ATGTTTTCATTGGGGAGAACTGG - Intergenic
1011372529 6:86652502-86652524 ATGTTACCACTGGGGGAAACAGG - Intergenic
1011777582 6:90748746-90748768 AAGCTAGCATTGGGCAAAAGTGG - Intergenic
1011835810 6:91430435-91430457 ATGTTACCATTTAGGAAAACTGG + Intergenic
1011879007 6:91999612-91999634 ATGCTTGCATGGGGGAATACAGG - Intergenic
1012289114 6:97429350-97429372 ATGTTACCATTGAGGAAAACTGG - Intergenic
1012556059 6:100513088-100513110 ATGCTACCTTTGGAGGAAACTGG - Intronic
1013152185 6:107457310-107457332 ATGTTACCATTGGGAGAAACAGG + Intronic
1013518973 6:110915315-110915337 ATGTTAACATTGTGGGAAACTGG - Intergenic
1013724117 6:113071325-113071347 ATGTAACCGTTGGGGAAAACTGG + Intergenic
1014568775 6:122983610-122983632 ATGTTACCATTGGGAGAAACTGG + Intergenic
1014776328 6:125514164-125514186 ATGTTATTATTGGGGGAAACTGG - Intergenic
1015324679 6:131911122-131911144 ATGTAATCACTGGGGAAACCAGG - Intergenic
1015468487 6:133575440-133575462 GTGTTACCATTGGGGAAAATTGG + Intergenic
1015979437 6:138824206-138824228 ATGGAACCATTGGGGAAAACTGG + Intronic
1016272580 6:142305604-142305626 ATGCTACCATTGGGGGAACTGGG - Intronic
1016469059 6:144355730-144355752 ATGTTAACAGTGGGGAAAACTGG - Intronic
1016469064 6:144355761-144355783 ATGTTAACAGTGGGGAAAACTGG - Intronic
1016787974 6:148034164-148034186 ATGTTACCACTGGGGAGAACTGG + Intergenic
1016903669 6:149128190-149128212 ATGTTAATATTGGGGTAAACTGG + Intergenic
1017145743 6:151233012-151233034 ATGTTACTATTGGGGAAAACTGG - Intergenic
1017276718 6:152578250-152578272 ATGTTAACATTGGGGCAGACCGG - Intronic
1018181950 6:161231481-161231503 ATGCTACCATAGGGAGAAACTGG + Intronic
1018360372 6:163061666-163061688 ATGCCTTCTTTGGGGCAAACAGG - Intronic
1019481933 7:1270852-1270874 ATGCATCCATTGGGGAATACTGG - Intergenic
1019495303 7:1335874-1335896 ATGTTACCATTGGGGAAAATCGG - Intergenic
1020155583 7:5721304-5721326 ATTCTACCATTTGGGAAGACTGG + Intronic
1020559642 7:9714816-9714838 ATGTTATGGTTGGGGATAACAGG + Intergenic
1021858576 7:24882490-24882512 ATGCAATCATTGGTGGAAACAGG + Intronic
1022039846 7:26570370-26570392 ATGCTATCATTTGGGGAAACAGG + Intergenic
1022250523 7:28602946-28602968 ATGTTACCATTGGAGGAAACTGG + Intronic
1022499717 7:30874878-30874900 ATGTTATCGTTGGGGGAAGCTGG + Intronic
1022597417 7:31725688-31725710 ATGTTACCACTGGGGGAAACTGG + Intergenic
1022793768 7:33715226-33715248 AAGTCATCATTGGGGGAAACTGG - Intergenic
1023937854 7:44752037-44752059 ATGTTACCATTGGGGCAAACTGG - Intronic
1023963256 7:44945446-44945468 ATGTTACCCTTGGGGGAAACTGG + Intergenic
1024895827 7:54260750-54260772 ATGTTACCATTGGGGGGAACTGG - Intergenic
1024962075 7:54987312-54987334 ATGCTATCTTTGAAGGAAACTGG + Intergenic
1026212910 7:68322826-68322848 AAGCTATCAGTGGGGAAGTCAGG - Intergenic
1027478166 7:78659770-78659792 ATGTTATCTTTGTGGACAACTGG + Intronic
1028121114 7:87058071-87058093 ATGTTGTAATTGGGGAAATCAGG - Intronic
1028393664 7:90343984-90344006 ATGTTAACATTCGGGCAAACTGG + Intronic
1028552748 7:92088888-92088910 ATGGTATCATTGGGAAAAGCTGG + Intronic
1028669959 7:93390487-93390509 ATGTTGCCATTGGGGAAAACTGG + Intergenic
1028676435 7:93468520-93468542 ATCCTATCTTTGGGGAGAACAGG - Intronic
1028924598 7:96344212-96344234 ATGTAACCACTGGGGAAAACTGG - Intergenic
1028997706 7:97119527-97119549 ATGCTAACACAGGGGGAAACAGG - Intronic
1029067211 7:97862676-97862698 ATGTTAAGAGTGGGGAAAACTGG + Intronic
1029834279 7:103292839-103292861 ATGTTATTGTTGGGGCAAACTGG - Intergenic
1030121652 7:106115865-106115887 ATGTTAACATTAGGGGAAACTGG - Intergenic
1030547911 7:110920851-110920873 ATGTTAACATTAGGGAAAGCTGG - Intronic
1030576765 7:111297301-111297323 ATGTTATCACTGGAGAAAACTGG + Intronic
1031334379 7:120509341-120509363 ATGTTAATAATGGGGAAAACTGG + Intronic
1031510172 7:122639408-122639430 GTGCTATCATTAGGGAAAACTGG - Intronic
1031717615 7:125127913-125127935 ATGTTACCTTTGGGGGAAACTGG - Intergenic
1032003139 7:128278934-128278956 ATGTTACCATTGGGAGAAACTGG + Intergenic
1032273770 7:130436592-130436614 ATATAATCATTGGGGAAAATGGG + Intronic
1032616511 7:133478177-133478199 ATGGAATCATTGCAGAAAACAGG + Intronic
1032736514 7:134697377-134697399 AGGTCATCATTGGGGAAAGCAGG - Intergenic
1032748979 7:134817399-134817421 ATGTTACTACTGGGGAAAACTGG - Intronic
1033332012 7:140424540-140424562 ATATTACCATTGGGGGAAACAGG + Intronic
1033969652 7:147024438-147024460 ATGTTATTATTGGAGGAAACGGG + Intronic
1034109670 7:148524414-148524436 ATGTTAGTATTGGGGGAAACTGG - Intergenic
1034711440 7:153194898-153194920 ATGTTACCCTTGGGGGAAACTGG + Intergenic
1035953400 8:4049774-4049796 ATGCTAACAGTAAGGAAAACGGG - Intronic
1037484659 8:19335991-19336013 AGGCTATCATATGGGAATACAGG + Intronic
1037515553 8:19627947-19627969 ATGTTATCACTGGAGAAAGCTGG + Intronic
1037984542 8:23279977-23279999 ATGTTACCAGTGGGGGAAACTGG - Intronic
1038027507 8:23605351-23605373 ATGCTATCTTTGGGTAAGATGGG + Intergenic
1039204635 8:35138146-35138168 ATGTTACCATTGGAGAAAGCTGG + Intergenic
1039749745 8:40466476-40466498 ATGCTAACATTAGGGGAAGCTGG + Intergenic
1040669747 8:49675388-49675410 ATGCAACCACTGGGAAAAACAGG + Intergenic
1041025949 8:53687125-53687147 GTGTTATCCTTGGGGAAAACTGG + Intergenic
1041557881 8:59179281-59179303 ATGCTACCATTGGAGAAAACTGG - Intergenic
1042290421 8:67165332-67165354 ATGTTAACAATAGGGAAAACTGG - Intronic
1042292197 8:67180684-67180706 ATGTTACCATTGGGGGAAACTGG + Intronic
1042896526 8:73675978-73676000 ATGCTATCAATGGGGAATAAAGG + Intronic
1043504838 8:80892251-80892273 ATGTTACCGTTGGGGAAAACTGG + Intergenic
1044055351 8:87562942-87562964 ATGCTATCATTGAGGAAAACGGG - Intronic
1044189605 8:89299446-89299468 ATGCTTATATTGGGGAAAAAGGG + Intergenic
1044310799 8:90689840-90689862 ATGTTAACAATAGGGAAAACTGG - Intronic
1044980502 8:97711547-97711569 ATGTTACCACTGGGGAAAACTGG - Intronic
1045074282 8:98545396-98545418 ATGCCATCATTGCTAAAAACAGG + Intronic
1045257102 8:100535406-100535428 ATGTTACCATTGGGGGAAACTGG - Intronic
1045410636 8:101913976-101913998 ATGTTAATATTTGGGAAAACTGG - Intronic
1045466523 8:102475615-102475637 ATGTTACCATTGAGGGAAACTGG + Intergenic
1046230088 8:111344324-111344346 ATGTTATCATTGGGGGAAGGAGG + Intergenic
1047065449 8:121277095-121277117 ATGTTACCATTGGGGGAAACTGG - Intergenic
1047199469 8:122752713-122752735 ATGTAATCACTGGGGGAAACTGG + Intergenic
1047201147 8:122768906-122768928 ATGTTATCGTTTAGGAAAACTGG + Intergenic
1047335280 8:123930079-123930101 ATGTTACCTTTGGGCAAAACTGG - Intronic
1050522273 9:6513234-6513256 ATGCTATCCCTGAGGGAAACTGG - Intergenic
1051491279 9:17669178-17669200 ATGTTACCACTGGGGAAAACTGG - Intronic
1051807260 9:21008815-21008837 ATGTTATCATTAGGGTAAGCTGG + Intronic
1051887394 9:21907906-21907928 ATGTTACCATTGGGAGAAACTGG - Intronic
1052450975 9:28630983-28631005 ATGTTACCATTGGAGAAAACTGG + Intronic
1052505001 9:29341819-29341841 ATGTTACCATTTGGGAAAATTGG - Intergenic
1052628172 9:31003606-31003628 ATGTTACCACTGGGGAAAAATGG - Intergenic
1052747875 9:32458715-32458737 ATGTTAACATTTGGGGAAACTGG - Intronic
1055310586 9:74975502-74975524 ATGCTATCTTTGGGGGAAGCTGG + Intergenic
1055314859 9:75023996-75024018 ATACCACCATTGGGGAAAAATGG - Intronic
1055523810 9:77109816-77109838 ATGTTATCATTGGGTAAAATTGG + Intergenic
1055529810 9:77172658-77172680 ATGTCACCATTGGGGAAAACTGG - Intergenic
1056057031 9:82835733-82835755 ATACTACAATTGGGGGAAACTGG + Intergenic
1056175261 9:84028616-84028638 ATGCTATCATTTTGGAAAACTGG - Intergenic
1056739522 9:89242227-89242249 ATGTTACCACTGGGAAAAACTGG + Intergenic
1056875771 9:90328989-90329011 ATGTTACCATTGGCGAAACCTGG - Intergenic
1057073595 9:92121895-92121917 ATGTTAACACTGGGGAAAACTGG - Intergenic
1057107674 9:92435424-92435446 ATGTTATCATTAGGGGAAACTGG - Intronic
1057264484 9:93605086-93605108 ACGCTATGAATGGGGAAATCGGG - Intronic
1057425979 9:94950148-94950170 ATGCTGTCATGGGGGAAAGCTGG - Intronic
1057811263 9:98258580-98258602 ATGTTAACATTAGGGGAAACTGG - Intergenic
1058571339 9:106348621-106348643 ATGTTGACATTGGGGAAAACTGG + Intergenic
1058834120 9:108846028-108846050 ATGTTACCACTGGGGGAAACTGG - Intergenic
1059192341 9:112338403-112338425 ATGTTACTATTGGGGGAAACTGG + Intergenic
1059254673 9:112918734-112918756 ATATTATCGCTGGGGAAAACTGG + Intergenic
1059526791 9:114999564-114999586 ATACTACCATTGGGGGAAACTGG - Intergenic
1059720559 9:116955933-116955955 ATGCTATCATGGGGAAGGACAGG + Intronic
1060020754 9:120128784-120128806 ATGGTACCATTGGGGGAACCTGG + Intergenic
1060037478 9:120268533-120268555 ATGCTGCCATTGGGGGAAACTGG + Intergenic
1060632545 9:125172907-125172929 ATGTTACCACTGGGGAAAACTGG + Intronic
1203696772 Un_GL000214v1:105717-105739 ATGATATAATTGGGTAGAACTGG - Intergenic
1203552442 Un_KI270743v1:175312-175334 ATGATATAATTGGGTAGAACTGG + Intergenic
1186039512 X:5460704-5460726 ATGCTGACTTTGGGGAAAAGGGG - Intergenic
1186043389 X:5506549-5506571 ATGTTACCATTGGGGGAAATTGG - Intergenic
1186157735 X:6743051-6743073 ATGCTTTCAGTAGGGGAAACTGG + Intergenic
1186725354 X:12352075-12352097 GTGCTAACACTTGGGAAAACTGG - Intronic
1187049591 X:15682689-15682711 ATATTCTCCTTGGGGAAAACAGG - Intergenic
1187118415 X:16378686-16378708 ATGTTAACATTGGGGAAACGGGG + Intergenic
1187316423 X:18199534-18199556 ATGTTATCATTGAGGAAAATGGG + Intronic
1187316780 X:18203312-18203334 ATGTTACCACTGGGGAAAATTGG + Intronic
1187465141 X:19520284-19520306 ATGTTAACATTGGGACAAACTGG - Intergenic
1187539427 X:20177232-20177254 ATGTTACCATTGGGGGAAACTGG - Intronic
1187775106 X:22747637-22747659 ATGCTATGCTAGGGGAAAAAGGG + Intergenic
1188063266 X:25626968-25626990 ATGGTAGCATTAGGGAAAACTGG - Intergenic
1188249298 X:27873189-27873211 ATGTTTCCATTGGGGGAAACTGG - Intergenic
1188270590 X:28135199-28135221 GTGCTACCATTGTGGAGAACTGG - Intergenic
1188570216 X:31576097-31576119 ATGCTATCATTGGGAGAAGCTGG - Intronic
1188666636 X:32830561-32830583 ATGTTTTCATTGTGCAAAACAGG - Intronic
1188707647 X:33355753-33355775 ATGTTATCATTGGGAGAAACTGG - Intergenic
1189527268 X:41837225-41837247 ATGCTACTATGGGGGAAAATGGG - Intronic
1189762060 X:44331950-44331972 ATGTTACCATTGGGGCAAATGGG + Intronic
1189823130 X:44889925-44889947 ATGCTACAGTTGGGGGAAACTGG - Intronic
1189826259 X:44921275-44921297 ATGCTAACATTGGGGAAAGTTGG - Intronic
1189964296 X:46355745-46355767 ATGTTATCATTGGATGAAACTGG + Intergenic
1190000211 X:46678821-46678843 ATGTAACCATTGGGGGAAACTGG - Intronic
1190263270 X:48812880-48812902 AAAATATCATTGGGGAAGACAGG - Intronic
1190393674 X:49957852-49957874 ATGCTATCACTGGAGGAATCTGG - Intronic
1190444780 X:50513859-50513881 ATGTTATCCTTGTGGGAAACTGG + Intergenic
1190892340 X:54581145-54581167 ATGTTACCATTGGGGGAAACTGG - Intergenic
1191776898 X:64824179-64824201 ATGCTGTCATTGGAGACTACAGG + Intergenic
1192006696 X:67221732-67221754 AAGCTATCGTTGGAGTAAACAGG + Intergenic
1192254776 X:69447148-69447170 ATGTTACCATTGGGGGAAACTGG - Intergenic
1192374091 X:70541468-70541490 TTGTTATCGTTGGGGGAAACTGG + Intronic
1192734607 X:73837623-73837645 ATGTTAACACTGGGAAAAACTGG + Intergenic
1192835732 X:74797390-74797412 ATGATAACATTAGGGGAAACTGG + Intronic
1192960279 X:76122857-76122879 ATGTAATCATTAGGGAAATCTGG + Intergenic
1194682783 X:96873830-96873852 ATGTTACCATTGGGGGAAAAGGG + Intronic
1194793951 X:98186795-98186817 ATGTTTTCATTTGGGAAAAAAGG + Intergenic
1194794344 X:98192117-98192139 GTGGTACCATTGGAGAAAACTGG - Intergenic
1195066316 X:101241369-101241391 ATGTTGTCATTTGGGGAAACTGG + Intronic
1195141844 X:101968410-101968432 ATGCTAACTTTTGGGAAATCTGG + Intergenic
1195303617 X:103556939-103556961 TTTCTATCATTGGGTAATACAGG - Intergenic
1195903284 X:109820387-109820409 ATGCCACCACTGGGGAAATCTGG - Intergenic
1195911446 X:109892014-109892036 ATGTTACCATTGGGGAAAACTGG - Intergenic
1195977467 X:110543132-110543154 ATGCTACCTTTGGGGAAAATTGG + Intergenic
1195992594 X:110697371-110697393 ATGTTACCATTTGGGGAAACTGG + Intronic
1196289125 X:113917798-113917820 ATGTTACCATTGAGGAAAACTGG - Intergenic
1196755979 X:119157661-119157683 ATGTTACCATTGGGGGAAACTGG - Intergenic
1196936069 X:120732282-120732304 ACACTGTCATTGGGGGAAACCGG + Intergenic
1197555813 X:127951505-127951527 GTGTTATCATTGGGCAAAAAAGG - Intergenic
1197686835 X:129449085-129449107 ATGTTACTATTGGGGAAAACTGG + Intronic
1197841998 X:130758124-130758146 ATGCTACCATTGGGAGAAAATGG - Intronic
1197921003 X:131593941-131593963 ATGCCATCATAGGGAAAAAGAGG - Intergenic
1197998377 X:132405476-132405498 ATGTTAACAGTGGGGAGAACTGG + Intronic
1198058580 X:133020721-133020743 ATGCTGGCTTTGGGGAAAAAGGG + Intergenic
1198419719 X:136458601-136458623 ATGTCACCATTGGGGAAAACTGG - Intergenic
1198544917 X:137681205-137681227 ATGTTAACATGTGGGAAAACTGG + Intergenic
1198589986 X:138168025-138168047 ATGATAGCATTGGGGAAAACTGG - Intergenic
1198789177 X:140324171-140324193 ATGCTATCATTGGAAAAAACTGG + Intergenic
1199689723 X:150299456-150299478 ATGTTACCATTAGGGGAAACTGG + Intergenic
1199749941 X:150806131-150806153 ATGTTACCACTGGGGGAAACTGG + Intronic
1199823406 X:151473482-151473504 ATGATATAATTGGTGAATACAGG + Intergenic
1202582727 Y:26398978-26399000 ATGTTAACATTCGGGAAAGCTGG + Intergenic