ID: 924074579

View in Genome Browser
Species Human (GRCh38)
Location 1:240320064-240320086
Sequence GCATCCAGGTTAGCAGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924074579 Original CRISPR GCATCCAGGTTAGCAGCAAC TGG Intronic
901932900 1:12608336-12608358 GCATCCAGTTCAGAAGCCACAGG + Intronic
902111015 1:14078328-14078350 GCATCGTGATTGGCAGCAACAGG + Intergenic
904624426 1:31794050-31794072 GCGTGCAGTTCAGCAGCAACAGG - Intronic
906781617 1:48577715-48577737 GCATCCAGCAGAGCTGCAACTGG + Intronic
921919930 1:220656288-220656310 GCATCCAGGTAGGCAGGAACAGG + Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1072211231 10:93248828-93248850 GGATCCAGGTTAGCAGAGGCCGG + Intergenic
1072636823 10:97183769-97183791 GCAACCAGGGTAGCAGCTTCAGG + Intronic
1073510065 10:104037350-104037372 GCATGAAGGTTGGCAGCATCTGG - Intronic
1073716562 10:106114756-106114778 GCATCCAGCAGAGCAGCTACCGG - Intergenic
1073902399 10:108238337-108238359 ACATCAAGGGTAGCAGCAATGGG - Intergenic
1075685697 10:124363918-124363940 GCAACCAGGTAAGCACCAAAGGG + Intergenic
1085438071 11:76528355-76528377 GCATCCAGGGTAGCAGAGGCTGG + Exonic
1085796040 11:79540865-79540887 TCTTCCAGGTGAGCAGCAGCTGG + Intergenic
1087976306 11:104551943-104551965 GAATCCAAATTAGCAGCAAGAGG + Intergenic
1088634931 11:111810391-111810413 GTATCCATGTTATCAGCAACTGG - Intronic
1094573649 12:31664034-31664056 GCATACAAGATAGCAGAAACAGG - Intronic
1100662617 12:96716662-96716684 GCCTCCAGGATAGCAGCACTTGG - Intronic
1106645665 13:31631051-31631073 GCCTACAGGTTAGCAGAATCAGG - Intergenic
1110719971 13:78750133-78750155 GTCTGCAGCTTAGCAGCAACAGG - Intergenic
1112373970 13:98821406-98821428 GCCCCGAGGTTAGCAGCAGCTGG - Intronic
1113148177 13:107232210-107232232 GCATCCAGGGTAGGAATAACAGG - Intronic
1117414261 14:55479251-55479273 GGATGCAGGATAGCAGCAAGGGG - Intergenic
1118765034 14:68903963-68903985 GCATCCTGGCTAGCAGCATCTGG + Intronic
1119137900 14:72237745-72237767 GCATGCAGGTGAGCAGGTACAGG + Intronic
1127562372 15:60151980-60152002 GCCTCCAGGTTATCAACATCAGG + Intergenic
1127966891 15:63929330-63929352 GCATCCAGGGGAGCAGCCTCAGG - Intronic
1130846610 15:87753635-87753657 GAATCCAGGATAGCAGGGACAGG + Intergenic
1131058923 15:89392492-89392514 GCATCCAGCTCAGCAGAACCGGG + Intergenic
1132745256 16:1433716-1433738 GATTCCAGGTGAGCAGCAAGGGG + Intergenic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1136508691 16:30722730-30722752 TCACCCTGGTTAGCAGCAAGCGG - Exonic
1139544650 16:67644692-67644714 GACTCCAGGTTCGGAGCAACGGG + Intergenic
1141299552 16:82801268-82801290 CCAGCCAGGTTAACAGAAACAGG - Intronic
1142223360 16:88865860-88865882 GCCTCCAGGAGTGCAGCAACAGG - Exonic
1144858202 17:18282569-18282591 GCCTGCAGGTTGGCAACAACAGG + Intronic
1165146849 19:33736308-33736330 CCATCCTGATTAGCAGCATCCGG - Intronic
1165355291 19:35300235-35300257 GCATCCAGGTCAGCAGCGGCGGG - Exonic
926992059 2:18690534-18690556 GCAGCCAGGGTGGCAGCAAGGGG + Intergenic
928155801 2:28875340-28875362 GATTCAAGTTTAGCAGCAACTGG - Intergenic
936252202 2:110875614-110875636 GGATCGAGGTGAGCAGCAAGGGG - Intronic
937222552 2:120350146-120350168 GCCTCCAGGATACCAGCAAATGG + Exonic
937231207 2:120399078-120399100 GCATCCAGCTTATCATCATCCGG - Intergenic
1170676129 20:18482550-18482572 GCATACAGCTTAGAAGTAACCGG + Intronic
1170696141 20:18660878-18660900 GCTTCCATGTTAGGAGAAACCGG - Intronic
1174782152 20:53399716-53399738 GCAGCCAGGTCAGCAGCGACTGG - Intronic
1177147612 21:17423341-17423363 GCATCCAGGTAAGCTGCAGCTGG + Intergenic
1178162805 21:29939101-29939123 GGATCCAGGTTCGCAGGGACCGG - Intronic
1179929442 21:44557675-44557697 GCATCCAGGCTGACAGCACCAGG - Intronic
1183887035 22:40892538-40892560 GGAGCCAGGCTAGGAGCAACTGG - Intronic
949602426 3:5614754-5614776 GGATCCAGATGAGCACCAACAGG - Intergenic
957957479 3:87207102-87207124 GCATCCATGTTAACAAGAACTGG + Intergenic
965921756 3:173925554-173925576 GCTCCCAGGTTAGCAGAAAGTGG - Intronic
969663384 4:8543405-8543427 ACATCCAGGTTAACAGGAGCCGG - Intergenic
970316782 4:14835602-14835624 GAAGTCAGGTTAGCAGTAACTGG + Intergenic
980236139 4:130109145-130109167 CCATCCAGTTCAGCAGCAAAGGG - Intergenic
980368087 4:131832400-131832422 GCATGCAGGTGAGCAGGTACAGG + Intergenic
981823617 4:148914520-148914542 GCAGCCAGGACTGCAGCAACAGG + Intergenic
982243439 4:153323899-153323921 GGATCCATGTTATCTGCAACTGG + Intronic
986167488 5:5287923-5287945 GCATCCAGGTTCGCTGCAGGAGG + Intronic
990551703 5:56887437-56887459 GCAGCCAGGTTGGCATCAAAAGG + Exonic
992143309 5:73820649-73820671 GCATCTAGGTCAGCAGCCAGGGG - Intronic
994089018 5:95792102-95792124 GCAGGCAGGGCAGCAGCAACAGG + Intronic
995760122 5:115553701-115553723 CCCTCCAGGTTAGCAGAAGCTGG - Intergenic
997266170 5:132496503-132496525 GCAGCCGGGTCAGCAGCTACAGG + Intergenic
1003139000 6:3456244-3456266 GGATCCAGGTGAGCAGCACGAGG + Exonic
1004604012 6:17176929-17176951 GCCTCCAGGTCAGCATGAACTGG - Intergenic
1007595206 6:43046865-43046887 GCATCCAGGTCAGGAGGAAGGGG - Exonic
1010916119 6:81621329-81621351 TGTTCCAGGTTACCAGCAACAGG - Intronic
1014565026 6:122938228-122938250 GCATCCAGTTCAGGAGCAAAAGG - Intergenic
1015692775 6:135944098-135944120 GAATCCTGGTGAGCAGCACCAGG + Intronic
1017237771 6:152135138-152135160 GCATCAAGGTTAGAATCAATAGG + Exonic
1018177368 6:161188950-161188972 GCATCAGGGTCAGCAGCAGCTGG - Intronic
1018681930 6:166271760-166271782 CCATCAAGGATAGCAGCTACTGG + Intergenic
1023913141 7:44569331-44569353 ACATGCAGGTTAGCTGCACCTGG + Intronic
1026603088 7:71792870-71792892 GAAACAAGGTTACCAGCAACAGG + Intronic
1029270172 7:99372895-99372917 GAAGCCAGGGAAGCAGCAACAGG + Intronic
1030699431 7:112622217-112622239 GAATCCAGGGTGGCAGCAGCAGG + Intergenic
1032719953 7:134542679-134542701 GCAACTAGTTTAGCAGCAGCAGG - Intergenic
1032724853 7:134581095-134581117 GCAACTAGTTTAGCAGCAGCAGG - Intergenic
1034688400 7:152994493-152994515 GCTTCCTGGTTAGAAGGAACAGG + Intergenic
1036990977 8:13593514-13593536 GCATCCAGGTTACCTAGAACTGG - Intergenic
1039672127 8:39613056-39613078 GCATGCATGGCAGCAGCAACAGG - Intronic
1042134636 8:65621269-65621291 GCTTCCACATTAGCAGCAACAGG + Intronic
1042146711 8:65737275-65737297 GCTTCCACATTAGCGGCAACAGG + Intronic
1044333073 8:90944088-90944110 ACATCCAGCTTAGAAGGAACTGG + Intronic
1049339116 8:142102520-142102542 GCATCCAGGTTGGCAGGGAAGGG - Intergenic
1051792438 9:20821856-20821878 TCATCCATGTTATCAGCATCTGG - Intronic
1053632440 9:39958102-39958124 GCATGCAGGTGAGCAGGTACAGG + Intergenic
1053773320 9:41505429-41505451 GCATGCAGGTGAGCAGGTACAGG - Intergenic
1054211448 9:62292595-62292617 GCATGCAGGTGAGCAGGTACAGG - Intergenic
1054313534 9:63556258-63556280 GCATGCAGGTGAGCAGGCACAGG + Intergenic
1054747153 9:68866035-68866057 TCATCCAAGGTAGCAGCAGCAGG + Intronic
1056788825 9:89612130-89612152 GCATCCAGGTGAGAAGCAGGTGG - Intergenic
1060186886 9:121568945-121568967 GCTTCCAGGAGATCAGCAACCGG - Intronic
1060502724 9:124174215-124174237 GCTTGGAGGTTAGAAGCAACAGG + Intergenic
1187576033 X:20556512-20556534 GCATCCAGATGTGCAGCACCAGG + Intergenic
1190970098 X:55340382-55340404 GCAGCCATGTTAACTGCAACAGG + Intergenic
1192459437 X:71304372-71304394 GCCTACAGGTTAACAGCAAATGG - Intronic
1197832068 X:130653655-130653677 CCTTCCATGTTAGCAGCAAGTGG + Intronic
1198699609 X:139382716-139382738 GTAACCAGGTAACCAGCAACCGG + Intergenic
1199773329 X:150989243-150989265 GCATCCAGGAGACCAGCAGCAGG - Exonic
1201969072 Y:19771621-19771643 GCATACAGGTGAGCAGGTACAGG - Intergenic