ID: 924075245

View in Genome Browser
Species Human (GRCh38)
Location 1:240327347-240327369
Sequence GATGCAGGTTTTCAGTTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924075245_924075247 22 Left 924075245 1:240327347-240327369 CCTATCAACTGAAAACCTGCATC 0: 1
1: 0
2: 0
3: 22
4: 200
Right 924075247 1:240327392-240327414 AGCAGAACCTAGCTTTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924075245 Original CRISPR GATGCAGGTTTTCAGTTGAT AGG (reversed) Intronic
903197266 1:21700157-21700179 AATGCAGGTTTTCAGTTTAAAGG - Intronic
903757409 1:25672249-25672271 TATGCAGGCCTTCAGCTGATGGG + Intronic
905913470 1:41669535-41669557 TATTCAGGTCTTCAGTAGATTGG - Intronic
907753760 1:57289180-57289202 GATTCAGGTTTTCAGGACATTGG - Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
908949372 1:69541106-69541128 TATTCAGGCTTTCAGTTGATTGG + Intergenic
909363871 1:74797316-74797338 TATTCAGGCCTTCAGTTGATTGG - Intergenic
909609811 1:77540060-77540082 GATGGAGGGTGTCAGATGATGGG - Intronic
910337007 1:86145263-86145285 GAACCAAGTTTTCAGTTGAGTGG - Intronic
918372359 1:183873872-183873894 GAAGCAGGTTCTCCTTTGATGGG - Intronic
922772611 1:228195258-228195280 TATTCAGGTTTTCAACTGATCGG - Intergenic
924075245 1:240327347-240327369 GATGCAGGTTTTCAGTTGATAGG - Intronic
1064833551 10:19499422-19499444 TATTCAGGCCTTCAGTTGATTGG - Intronic
1065558224 10:26937380-26937402 GTTGGTGGTTTTCAGTTGTTGGG - Intergenic
1065864822 10:29905380-29905402 GATGCATATTTTCAGTCCATAGG + Intergenic
1066332137 10:34435566-34435588 GATACAAGATTTCTGTTGATGGG - Intronic
1067767163 10:49095499-49095521 GATGCATGTTTGCAATTGTTGGG - Intronic
1067927978 10:50530067-50530089 TGTGCAGGTTTTCAGGAGATGGG - Intronic
1067962901 10:50876503-50876525 TATTCAGGTTTTCAATTGATTGG - Intronic
1068023965 10:51619371-51619393 GAAGGAGGTTTTCATTTGACTGG + Intronic
1068770030 10:60810552-60810574 GATTTGGGTTTTCAGATGATCGG + Intergenic
1069181183 10:65360980-65361002 TATTCAGGTTTTCAGCAGATTGG - Intergenic
1069227838 10:65966663-65966685 ACTGCAGATTTTCAGTTGGTGGG + Exonic
1070438647 10:76419551-76419573 GATGTAAGTTTTCAATTCATTGG + Intronic
1070821626 10:79359051-79359073 TATTCAGGTCTTCAGTTGACTGG - Intergenic
1071829733 10:89359762-89359784 GATCCAGGCCTTCAGTGGATGGG - Intronic
1074234324 10:111569781-111569803 AATGCAGATTCTGAGTTGATAGG - Intergenic
1074540345 10:114360153-114360175 TATTCAAGTCTTCAGTTGATTGG - Intronic
1074594134 10:114844673-114844695 GATGGAGGTTCTCAGCTGCTGGG - Intronic
1075362300 10:121849387-121849409 GAAGCAGGTTTTCAGATGGGAGG - Intronic
1075921728 10:126218912-126218934 GATGCAGCTGTGCAGTTGATGGG - Intronic
1077296699 11:1829736-1829758 GATGCAGATTCTCAGAGGATAGG + Intronic
1077781620 11:5336271-5336293 TATTCAGGTTTTCAACTGATTGG - Intronic
1080271806 11:30458501-30458523 AATTCAGGTTCTGAGTTGATTGG - Intronic
1082135052 11:48538692-48538714 GATGCATTTTTCCAGTTGCTGGG + Intergenic
1084433533 11:69124370-69124392 CATGCAGGTTTTCACTGCATGGG - Intergenic
1087273394 11:96135996-96136018 CATGCTGGTTTTCACTTAATGGG - Intronic
1087734244 11:101813922-101813944 TATTCAGGTCTTCAATTGATTGG - Intronic
1088693631 11:112348201-112348223 TATTCAGGTCTTCAATTGATTGG - Intergenic
1089790899 11:120942701-120942723 CATACAGGTTTTCAGGTGGTAGG - Intronic
1090813739 11:130271803-130271825 GATGTATGTTTTCAGTTTGTTGG + Intronic
1091426074 12:390537-390559 TATTCAGGCCTTCAGTTGATTGG - Intronic
1092027920 12:5258531-5258553 TATTCAGGCCTTCAGTTGATTGG - Intergenic
1092921269 12:13233570-13233592 TCTGCAGGTCTTCACTTGATTGG + Intergenic
1093008486 12:14078455-14078477 TATGCAGGCTTTCAATGGATTGG + Intergenic
1093298886 12:17428541-17428563 GATTCAGTGTTTCACTTGATGGG + Intergenic
1094310226 12:29072615-29072637 TATGCAGGCCTTCAGTTGATGGG - Intergenic
1095349691 12:41193975-41193997 GTTGCAGGTTTACAGAGGATTGG + Intronic
1098663528 12:73130805-73130827 TATTCAGGTCTTCAATTGATTGG - Intergenic
1099867707 12:88304515-88304537 TATTAGGGTTTTCAGTTGATTGG - Intergenic
1100654888 12:96632468-96632490 GTTGCAGGTATTCAGTTGGCCGG + Intronic
1103759574 12:123238741-123238763 GCTGCAGGTTCTCATTTGGTAGG + Intronic
1103972645 12:124681749-124681771 GATGCAGGTTCTGATTTCATAGG - Intergenic
1104276606 12:127334275-127334297 GTTGCAGGTGTACAATTGATAGG - Intergenic
1104417180 12:128605387-128605409 TGTTCAGGTTTTCAGTTGATTGG + Intronic
1105642261 13:22278012-22278034 GACGCAGGAAGTCAGTTGATTGG + Intergenic
1108115914 13:47128087-47128109 GATACTTGTTTTCTGTTGATTGG + Intergenic
1108143269 13:47448875-47448897 TATTCAGGTCTTCAGTGGATTGG - Intergenic
1110466174 13:75804761-75804783 GATGCATGACTTCAGTTTATTGG + Intronic
1112947727 13:104952207-104952229 GATTCAACTTTTCAGTTCATTGG - Intergenic
1113096522 13:106670089-106670111 TCTGCAGGATATCAGTTGATAGG - Intergenic
1116159337 14:41248873-41248895 AAGGCAGGGTTTCACTTGATAGG + Intergenic
1116441427 14:44958751-44958773 GTTGCAGTTTTTCAGTGGACAGG - Intronic
1120400028 14:84019242-84019264 GAAGTTGGTTTTCAGTTGATGGG - Intergenic
1126459256 15:48897646-48897668 GATGCAGTTCTTCAGTAAATAGG + Intronic
1126689470 15:51277704-51277726 TCTGTAGGTTTTCATTTGATGGG - Intronic
1126855679 15:52837180-52837202 TATTCAGGTCTTCAATTGATTGG - Intergenic
1127844312 15:62856470-62856492 GGTCCAGGCTTCCAGTTGATTGG - Intergenic
1128718968 15:69931621-69931643 GAAGCAGGTTTTCACCTGAAAGG - Intergenic
1129531947 15:76273777-76273799 GATACAGATTTTCAGTGAATAGG - Intronic
1134292181 16:12910891-12910913 TATCCAGGCTTTCAGATGATTGG + Intronic
1142613544 17:1122435-1122457 AATTCAGGTGTTCAGTGGATTGG - Intronic
1149350514 17:55782189-55782211 GATTCAGGCTTTCAGCTGACTGG + Intronic
1151781405 17:76248572-76248594 GAGGCAGGATTTCAGCTGAGTGG - Intergenic
1154009195 18:10560806-10560828 GCTGCAAGTTTTCATCTGATCGG - Intergenic
1156600755 18:38603165-38603187 CATTCAGGTCTTCAATTGATTGG + Intergenic
1156713239 18:39974364-39974386 AAAGCAGATATTCAGTTGATTGG - Intergenic
1158141531 18:54261146-54261168 TATTCAGGTTTTCAATGGATTGG - Intergenic
1164756518 19:30694066-30694088 GATGCCAGCTTTCAGTGGATTGG + Intronic
1167394472 19:49218994-49219016 GCTGCAGGTTTTCAGAGGAAAGG + Intergenic
1167527750 19:49995471-49995493 GATCCAGGTCTGCAGGTGATGGG + Intronic
1168463420 19:56581884-56581906 GATGCAGTTATTCTTTTGATTGG + Exonic
925106541 2:1297111-1297133 AATGCAGGTTTCCAGTAGAACGG - Intronic
926916019 2:17893175-17893197 CATGCAGGTTTTCAGTTAAGTGG + Intronic
927057167 2:19376044-19376066 CATTCAGATTTTCAATTGATTGG + Intergenic
927171036 2:20369723-20369745 ATTGCAGGTTTTCAGTTAACTGG - Intergenic
928777927 2:34789415-34789437 TATTCAGTTCTTCAGTTGATTGG - Intergenic
931615668 2:64154101-64154123 CCTGGAGTTTTTCAGTTGATGGG + Intergenic
931660669 2:64559569-64559591 TATTCAGGTCTTCAGCTGATTGG + Intronic
933205263 2:79499997-79500019 TATTCAGGCTTTCAGCTGATTGG + Intronic
933313995 2:80694011-80694033 GACGCAGGTTGTAAGTTGAATGG + Intergenic
934608563 2:95717175-95717197 GATGAATGTTTTCAGTGGACAGG - Intergenic
936964008 2:118108418-118108440 GATGCAGTTTTCCCCTTGATTGG + Exonic
937076899 2:119113683-119113705 CACGCAGGTTTCCATTTGATTGG + Intergenic
937271758 2:120657306-120657328 AATGCACGTTTTCAGCAGATTGG - Intergenic
938263020 2:129908715-129908737 GCTGCAGGTGTTCAGGTGAGCGG + Intergenic
938881028 2:135588460-135588482 CATACAGGTTTTCAGTTCATTGG + Intronic
941314188 2:163971990-163972012 GATCCAGGTATTCTGTTGAGGGG - Intergenic
942117265 2:172740308-172740330 GAGAAAGGTTCTCAGTTGATTGG + Intronic
945557014 2:211289677-211289699 GATGTAGGATTTGAGTTGAATGG - Intergenic
946618430 2:221534466-221534488 GATGCAGTTTTTCATCTGAGGGG - Intronic
946808307 2:223495145-223495167 TATGCAGTTTTTCACTTGGTGGG - Intergenic
948676193 2:239598210-239598232 GATTCGGGTCTTCAGCTGATTGG + Intergenic
1169034708 20:2440134-2440156 CATTCAGGCCTTCAGTTGATTGG + Intergenic
1169495436 20:6110445-6110467 GATGCTGGTGTTCCATTGATGGG + Exonic
1171220044 20:23387974-23387996 TATTCAGGTTTTCAGTAGATTGG - Intronic
1171726099 20:28622369-28622391 GTTGGTGGTTTTCAGTTGGTGGG + Intergenic
1171752036 20:29061007-29061029 GGTGGTGGTTTTCAGTTGGTAGG - Intergenic
1171790298 20:29516856-29516878 GTTGGTGGTTTTCAGTTGGTGGG + Intergenic
1173173114 20:40743227-40743249 GATCCAGGTTTTCAGCTGCCTGG + Intergenic
1175123467 20:56734733-56734755 GATGCAGATTTTTTGTTGTTTGG + Intergenic
1179611163 21:42551979-42552001 GATGAAGGTTTCCAGTTTACAGG - Intronic
1180391002 22:12281977-12281999 GTTGGTGGTTTTCAGTTGGTGGG + Intergenic
1180408740 22:12582780-12582802 GTTGGTGGTTTTCAGTTGGTGGG - Intergenic
1181608994 22:24000059-24000081 GATGCAGGTGTGGAGTGGATTGG - Intergenic
1183376857 22:37470389-37470411 GATGCATGTGATCAGATGATTGG - Intronic
949607493 3:5670292-5670314 TATGCAGGCTTTCAGTTTGTTGG + Intergenic
949707409 3:6834848-6834870 GATGCAGGCTATCAGGTGAGCGG + Intronic
950512641 3:13440991-13441013 TATCCAGGTCTTCAGGTGATTGG + Intergenic
954057227 3:48037235-48037257 GATGCAGCTTTTGAGTATATAGG - Intronic
958733423 3:97982957-97982979 GAAGCAGGTTTTCAATACATAGG + Intergenic
959100247 3:102001834-102001856 GAGGCAGGTTTTCACTGTATTGG - Intergenic
959239666 3:103773810-103773832 GATGCAGGATTTCTTTTGATTGG - Intergenic
959412543 3:106043177-106043199 TATTCAGGTCTTCAGTTGATTGG - Intergenic
959577161 3:107946841-107946863 TATTCAGGTCTTCAGTTGATTGG - Intergenic
960581970 3:119288881-119288903 GATGCAGGTATACAGCTGCTTGG + Intergenic
960646808 3:119894250-119894272 GATGTAAGTTTTCAGTTATTAGG + Intronic
962436867 3:135374935-135374957 GTGGCAGTTTTTCAGTTGAGGGG - Intergenic
965115858 3:164487231-164487253 TATTCAGGCTTTCAGCTGATTGG - Intergenic
967429363 3:189363857-189363879 TATGCAGGCCTTCAGTTGATTGG - Intergenic
967870907 3:194228220-194228242 TATGCAGGCCTTCAGTTGATTGG - Intergenic
969722836 4:8902452-8902474 GATTCAGGTTTTCACATCATTGG + Intergenic
969779365 4:9385674-9385696 GATGCATCTTTTCTGATGATAGG + Exonic
970804247 4:20011589-20011611 GATGCACATTTTTAGTTGTTTGG - Intergenic
973023124 4:45228757-45228779 GATGTATGTTTTCTCTTGATAGG + Intergenic
973848011 4:54932780-54932802 GATGGAGGATTTCAGTTATTGGG - Intergenic
974022033 4:56700248-56700270 TATTCAGGTTTTCAACTGATTGG - Intergenic
974379866 4:61125321-61125343 GATGTAGGCTTTCATTTTATAGG + Intergenic
974869533 4:67622633-67622655 GATTCAGCTCTTCAGTTAATAGG - Intronic
977283551 4:95072199-95072221 AATTCAGGCTTTCAGCTGATTGG + Intronic
977368989 4:96110722-96110744 TATTCAGCTATTCAGTTGATTGG + Intergenic
978890118 4:113815632-113815654 GATCCAGGTTTTCTTTAGATTGG - Intergenic
980437534 4:132797990-132798012 TATTCAGGTTTTCAATGGATTGG - Intergenic
980504103 4:133692326-133692348 CTTGCAGGGTTTCAGTTGAAAGG - Intergenic
986010640 5:3711756-3711778 TATGCAGGCTCTCAGCTGATTGG - Intergenic
988262244 5:28902846-28902868 GATGTAAGTTTCCAGTTGATTGG + Intergenic
988799883 5:34686388-34686410 GATGCAGCGTTTCAGTTAAGAGG + Intronic
989377945 5:40785169-40785191 GAGGCAGGTTTTCAGTACACTGG - Intronic
990053901 5:51545752-51545774 TATCCAGGTGTTCAGTAGATTGG - Intergenic
990791279 5:59483009-59483031 TATGCAGGCCTTCAGCTGATTGG - Intronic
997724735 5:136111080-136111102 CATCCAGGTTTCCAGATGATAGG - Intergenic
997785879 5:136713134-136713156 TATTTAGGCTTTCAGTTGATTGG - Intergenic
997957628 5:138292206-138292228 AATGCAGGTTTCCAGATGTTAGG + Intronic
999040077 5:148399460-148399482 GATGCATGTTTTCCGGTGAATGG + Intronic
999618241 5:153448301-153448323 GAGGAAGTTTTTCAGTTGCTAGG - Intergenic
999907430 5:156157478-156157500 GATGGAGGTTTTGAGTAGGTGGG - Intronic
1002675863 5:180912020-180912042 TATTCAGGTCTTCAGCTGATTGG - Intronic
1003358808 6:5403434-5403456 TGTTCAGGTTTTCAGTTGATAGG + Intronic
1003881833 6:10486237-10486259 TGTTCAGGTCTTCAGTTGATTGG - Intergenic
1003997141 6:11553270-11553292 AATGCAGGTTTGCAGTGCATGGG - Intronic
1004047460 6:12040045-12040067 GATGAAGGTTTTCTATAGATGGG + Intronic
1008024842 6:46623529-46623551 GATGCAGGCTCTCAGTGGATTGG - Intronic
1008433428 6:51446907-51446929 AATGCAGGTTTTGACTTGGTGGG - Intergenic
1010849962 6:80761728-80761750 GATGAAGATTTCCAGTTCATTGG - Intergenic
1018736708 6:166691990-166692012 GAGGGAGGATTTCAGCTGATGGG - Intronic
1018979442 6:168590594-168590616 GCTGCAGGTTTTAAGTTTTTTGG - Intronic
1024019917 7:45359402-45359424 GGAGGAGGTGTTCAGTTGATTGG + Intergenic
1024157254 7:46638260-46638282 GATGCAGGTTTCCAGAGGAAGGG - Intergenic
1024184276 7:46933179-46933201 AAAGCAGCTTCTCAGTTGATGGG + Intergenic
1024343613 7:48291356-48291378 AATGCAGGGGTTCAGTTGCTTGG + Intronic
1024565308 7:50675551-50675573 TATTCAGGTCTTCAGGTGATGGG - Intronic
1024726016 7:52196054-52196076 GATGCAGGTAATCAGATCATGGG + Intergenic
1025611748 7:63080686-63080708 GAAGCAGGTTGTCAGGTGTTGGG + Intergenic
1026064242 7:67055828-67055850 CACTCAGGTTATCAGTTGATTGG + Exonic
1026297039 7:69062079-69062101 TATTCAGGTCTTCAGCTGATTGG + Intergenic
1026503470 7:70962573-70962595 TATGCAGGCTTTCAGCTGATTGG - Intergenic
1026714106 7:72771618-72771640 CACTCAGGTTATCAGTTGATTGG - Intronic
1031040442 7:116833507-116833529 GATTCAGCTTTTCAGTTTCTGGG - Intronic
1032325848 7:130927514-130927536 GATGCAGGTATTCAGGAGAAGGG - Intergenic
1032629092 7:133627320-133627342 CATGAAGGTTTTCATTTGACTGG + Intronic
1033925804 7:146458774-146458796 GATTCAGGCTTTCAACTGATGGG - Intronic
1034158066 7:148971875-148971897 GGTGCATGTTTTCAGATGGTGGG - Intergenic
1034822023 7:154224513-154224535 GATGAAGCTTTGCAGTTGATTGG - Intronic
1035128043 7:156624748-156624770 GATGCAAAATTTCAGTTAATAGG + Intergenic
1035424633 7:158761142-158761164 GATGGAGATTTTCAGGTGTTTGG - Intronic
1037227150 8:16605923-16605945 TATTCAGGTTCTCAGTGGATTGG + Intergenic
1038526851 8:28281915-28281937 AATTCAGGCCTTCAGTTGATGGG - Intergenic
1039193100 8:34999195-34999217 AATGTAGGTGTTGAGTTGATGGG + Intergenic
1041072940 8:54142989-54143011 GATGCAGGTCTACAGTTCAGGGG - Intronic
1041150380 8:54926146-54926168 TATGCTGGTTTTGTGTTGATTGG - Intergenic
1042056783 8:64772400-64772422 TATTCAGGTTTTCAACTGATTGG - Intronic
1042172943 8:66010002-66010024 GATGCAGGATTTCAGTTTCATGG + Intergenic
1042274674 8:66991868-66991890 AATGCAGGTTCTGAGTTGTTAGG + Intronic
1043229711 8:77786757-77786779 CTTGCAGGGTTTCAGTTGAGAGG + Intergenic
1044020941 8:87105347-87105369 AATGCAGGCTTTCACTTTATTGG + Intronic
1045523171 8:102921013-102921035 CATGCAGGCCTTCAATTGATTGG + Intronic
1045757780 8:105566068-105566090 TATTCGGGCTTTCAGTTGATTGG + Intronic
1047607307 8:126488188-126488210 CATGCTGGTTTTGTGTTGATTGG + Intergenic
1048143476 8:131818595-131818617 GCTGCAGTTATTCAGTTGAAAGG + Intergenic
1048150528 8:131889182-131889204 TATTCAGGTCTTCAATTGATTGG - Intergenic
1051778457 9:20661489-20661511 GAGGCAGTTGTTCACTTGATGGG + Intronic
1053723520 9:40973520-40973542 GTTGGTGGTTTTCAGTTGGTGGG - Intergenic
1054342443 9:63878476-63878498 GTTGGTGGTTTTCAGTTGGTGGG + Intergenic
1055141523 9:72882183-72882205 AAAACAGGTTTTCAGTTGAAAGG - Intergenic
1055555312 9:77467702-77467724 GATGCAGGTTGTCAGAAGAATGG - Intronic
1055646607 9:78367334-78367356 GATGCAGGTCCTTATTTGATGGG + Intergenic
1059065916 9:111083524-111083546 GATGGAGGTTTTCAGATGAATGG + Intergenic
1203451639 Un_GL000219v1:122500-122522 GTTGGTGGTTTTCAGTTGGTGGG + Intergenic
1185729231 X:2447559-2447581 GGTGCAGGTATCCCGTTGATGGG - Intronic
1185732163 X:2469928-2469950 GATGCAGGTATCCCATTGATGGG - Intronic
1187641579 X:21296954-21296976 AATGCATGTTTACACTTGATAGG + Intergenic
1187905275 X:24060161-24060183 GATGCAGCTCTTCTGTTGATAGG + Exonic
1188278246 X:28228547-28228569 TATGAAGATTTTCAGCTGATTGG - Intergenic
1188609070 X:32073232-32073254 GCTGCAGGTTTTCAGTCCCTCGG + Intronic
1188678587 X:32973828-32973850 TGTGCATGTTTTCAGTTGTTTGG - Intronic
1189943656 X:46154355-46154377 TATTCAGGCCTTCAGTTGATTGG + Intergenic
1190680062 X:52818962-52818984 GATGGAGGTTTTCATTATATAGG - Intergenic
1190718597 X:53127609-53127631 GAAGCAAGTTCTCAGTTGGTAGG + Intergenic
1193350642 X:80460555-80460577 TATTCAGGTTTTCAGGGGATTGG - Intergenic
1193350685 X:80461461-80461483 TATTCAGGTTTTCAGGGGATTGG + Intergenic
1194279186 X:91926299-91926321 TATTCAGGCCTTCAGTTGATTGG + Intronic
1194634918 X:96333500-96333522 TATTCAGGCTTTCAGCTGATTGG + Intergenic
1200596660 Y:5149795-5149817 TATTCAGGCCTTCAGTTGATTGG + Intronic