ID: 924077560

View in Genome Browser
Species Human (GRCh38)
Location 1:240356633-240356655
Sequence AATCTGATCTTTAGAAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 423}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924077560_924077562 -2 Left 924077560 1:240356633-240356655 CCATCTCTTCTAAAGATCAGATT 0: 1
1: 0
2: 2
3: 29
4: 423
Right 924077562 1:240356654-240356676 TTTATATCATGCCATGCTCTGGG No data
924077560_924077564 18 Left 924077560 1:240356633-240356655 CCATCTCTTCTAAAGATCAGATT 0: 1
1: 0
2: 2
3: 29
4: 423
Right 924077564 1:240356674-240356696 GGGAAAGTTCTTGCTGTTTCAGG No data
924077560_924077561 -3 Left 924077560 1:240356633-240356655 CCATCTCTTCTAAAGATCAGATT 0: 1
1: 0
2: 2
3: 29
4: 423
Right 924077561 1:240356653-240356675 ATTTATATCATGCCATGCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924077560 Original CRISPR AATCTGATCTTTAGAAGAGA TGG (reversed) Intronic
901147236 1:7073504-7073526 AATCTGATGTTTAGAGGACAGGG + Intronic
901367003 1:8761066-8761088 AGTCTGAGCTTGAGAACAGAAGG - Intronic
901415844 1:9115701-9115723 TCTCTGAGCTTAAGAAGAGATGG - Intronic
902424173 1:16306187-16306209 AATTTTATTTTTAGTAGAGATGG + Intronic
902827056 1:18982903-18982925 AATGTGATCTGTAGATGACATGG + Intergenic
903452472 1:23463768-23463790 ATTTTTATCTTTAGTAGAGACGG + Intronic
904990337 1:34587615-34587637 ACTCTGAGCTATAGAGGAGAGGG - Intergenic
905121001 1:35681791-35681813 AATTTTATTTTTAGTAGAGACGG - Intergenic
905133965 1:35783904-35783926 AATGTGATCTGTAGTAGAGCTGG + Intergenic
905171133 1:36110413-36110435 AACCTGAGCTTTTGAAGAGATGG - Intronic
905256839 1:36690216-36690238 AATAGGATCTGAAGAAGAGATGG + Intergenic
905959071 1:42028225-42028247 AATCTAAGCTTTAGAAGAATAGG + Intronic
906175910 1:43772216-43772238 ATTTTGATTTTTAGTAGAGATGG + Intronic
906339163 1:44963050-44963072 CATCTAATTTTTTGAAGAGATGG - Intronic
906443498 1:45872649-45872671 TTTCTTATTTTTAGAAGAGACGG + Intronic
906497694 1:46317130-46317152 ATTCTTATTTTTAGTAGAGACGG - Intergenic
906958680 1:50399511-50399533 ATTTGGATTTTTAGAAGAGACGG + Intergenic
908042866 1:60133946-60133968 AAACTGCTCTTCAGAAAAGAAGG + Intergenic
908379020 1:63576648-63576670 AATTTTATTTTTAGTAGAGACGG - Intronic
909627207 1:77731223-77731245 AATCTGAAATTTAGATGACATGG - Intronic
910746885 1:90583787-90583809 AATTTGATTTGAAGAAGAGAAGG - Intergenic
910956713 1:92714594-92714616 AATCTTATTTTTCAAAGAGAGGG + Intronic
912997978 1:114550731-114550753 AATGTGAACTTGAGAAAAGAAGG + Intergenic
913505886 1:119515886-119515908 GATATGATCTCAAGAAGAGAAGG - Intergenic
916542038 1:165766324-165766346 AATCTTGTATTAAGAAGAGAGGG + Intronic
918000554 1:180490601-180490623 ATTTTTATCTTTAGTAGAGACGG - Intronic
918275516 1:182950453-182950475 CTTGTGATCTTTAGCAGAGAAGG - Intronic
918546700 1:185692507-185692529 TTTCTAATCATTAGAAGAGATGG + Intergenic
919282960 1:195516091-195516113 ACTCTGACCTTAGGAAGAGATGG - Intergenic
919483393 1:198117049-198117071 GAGCTGATCTGTAGAAGACAAGG - Intergenic
919502604 1:198356124-198356146 AACCTGATATTTGGATGAGAAGG - Intergenic
919526084 1:198652688-198652710 AATGGTAACTTTAGAAGAGAGGG + Intronic
919594097 1:199539920-199539942 AAACTAAGCTTTATAAGAGAAGG + Intergenic
920091806 1:203459245-203459267 AATTTTATTTTTAGTAGAGATGG + Intergenic
920307358 1:205027469-205027491 AATGTGTTTTTTAGTAGAGAAGG - Intergenic
921389066 1:214601359-214601381 AGTCTAATCTGTAGAAAAGATGG + Intergenic
922964452 1:229676500-229676522 AATTTTATTTTTAGTAGAGACGG + Intergenic
923094397 1:230763027-230763049 AATCTGGCCTTTGGAAGAGCTGG + Intronic
923565160 1:235070963-235070985 AATTTTATCTTTTGTAGAGATGG + Intergenic
924077560 1:240356633-240356655 AATCTGATCTTTAGAAGAGATGG - Intronic
1062998422 10:1890859-1890881 AATATTATCTTTTTAAGAGACGG - Intergenic
1063077321 10:2730434-2730456 AATTTTATTTTTAGTAGAGATGG - Intergenic
1064458488 10:15510487-15510509 TATTTTATTTTTAGAAGAGACGG - Intergenic
1064555561 10:16543892-16543914 AATTTTATTTTTAGTAGAGACGG + Intergenic
1065173258 10:23052784-23052806 AATCTGAGTTTTATAAGACACGG - Intergenic
1065179226 10:23108126-23108148 ATTTTGATTTTTAGTAGAGATGG + Intronic
1065895564 10:30160458-30160480 AATCTGAGCTCTAGAAGACTGGG + Intergenic
1066825303 10:39564940-39564962 AATCTGCTCTCTTTAAGAGAAGG - Intergenic
1068742927 10:60494995-60495017 AATCTGATCTTTTGTGGAAAAGG - Intronic
1068901925 10:62279248-62279270 AATTTTATTTTTAGTAGAGACGG - Intergenic
1068932127 10:62602402-62602424 AATCTGACTTTTAAAAGACAAGG + Intronic
1070950681 10:80428491-80428513 AAGCTTTTCTTTAGTAGAGATGG - Intronic
1071786069 10:88901442-88901464 AAGCTGATCTTTAAAAGTGAAGG - Intronic
1072725110 10:97807784-97807806 AATGTGATCTCTAGAACAGGTGG - Intergenic
1073230697 10:101967149-101967171 AACCTGTTCATTAGGAGAGATGG + Intronic
1073462703 10:103675869-103675891 AATTTTATATTTAGTAGAGATGG - Intronic
1074179004 10:111040521-111040543 AATCTGTTCTTTACAAATGAAGG + Intergenic
1074718396 10:116242449-116242471 ATTTTGATTTTGAGAAGAGAAGG + Intronic
1075148369 10:119903035-119903057 TATCTGATTTTAGGAAGAGAAGG + Intronic
1075159852 10:120013645-120013667 AATCTGGTCTTTAGGAGCTATGG - Intergenic
1075581138 10:123619522-123619544 ACTCTACTTTTTAGAAGAGAAGG + Intergenic
1078605105 11:12768194-12768216 AATCTGATATCTAGAAGTGCAGG - Intronic
1078950744 11:16131132-16131154 ACTTTGCTCTTTAGAAGACATGG + Intronic
1080089780 11:28332782-28332804 AATTTTATTTTTAGTAGAGATGG - Exonic
1080353592 11:31414716-31414738 AATCTGAGCTTTAGTTAAGAAGG - Intronic
1082636020 11:55595398-55595420 AATCTGTTCTTCAGAAAAAAAGG - Intergenic
1082666928 11:55986004-55986026 AATATTGTCTTTATAAGAGAGGG + Intergenic
1083392215 11:62361354-62361376 AATTTTATTTTTAGTAGAGACGG + Intronic
1083411176 11:62493502-62493524 AAGCTTATTTTTAGTAGAGACGG + Intronic
1083460924 11:62811248-62811270 GTTCTGATGTTTGGAAGAGAAGG - Intronic
1083930847 11:65843867-65843889 AATCTGATCTTTCAAAGAGGTGG + Intronic
1085128375 11:74017459-74017481 AGTCTGATCTTTAGCATTGAAGG - Intronic
1085285485 11:75357277-75357299 ATTCTTATTTTTAGTAGAGACGG + Intergenic
1086029741 11:82339724-82339746 ATTCTGTTCTTAGGAAGAGAGGG - Intergenic
1086139426 11:83478640-83478662 AATGTGATTTTTATAAGAAAAGG + Intronic
1086255074 11:84866067-84866089 AAACTGGTTTTTAGAAGAAATGG - Intronic
1086812455 11:91327696-91327718 AACCTGTTCTTTAGAAGTGCAGG + Intergenic
1087575714 11:99986543-99986565 AATGTGATGTTTGCAAGAGAGGG - Intronic
1088397094 11:109381128-109381150 AATCTGATTTTTATTAGAGCAGG + Intergenic
1088853681 11:113726908-113726930 ATTCTGATTTTTAGCAGAGTGGG - Intergenic
1088927555 11:114317676-114317698 AAGCTGATCTATACATGAGAAGG - Intergenic
1089241852 11:117088057-117088079 AATTTTATTTTTAGTAGAGATGG - Intronic
1090057986 11:123439629-123439651 ATTCTGATCTGTAGATGAGATGG + Intergenic
1091103762 11:132899454-132899476 AATCTCTTCCCTAGAAGAGAAGG - Intronic
1091912715 12:4244815-4244837 GATCTCTTCTTCAGAAGAGAAGG + Intergenic
1093897485 12:24591078-24591100 AATATTACCTATAGAAGAGAAGG - Intergenic
1093944978 12:25098292-25098314 AAATTGATATTTAAAAGAGAAGG - Intronic
1094462558 12:30712907-30712929 ATTTTGATTTTTAGTAGAGATGG + Intronic
1095056465 12:37610177-37610199 AAACTGCTCTTTATAAGGGAAGG - Intergenic
1098122215 12:67253725-67253747 AATGTGTTTTTTAGTAGAGACGG - Intergenic
1099902112 12:88723993-88724015 TATTTGATCTTAACAAGAGAAGG - Intergenic
1100342449 12:93692629-93692651 AAACCGTTCTTTAGAAGTGAAGG + Intronic
1100619021 12:96254152-96254174 TTTCTTATCTTTAGTAGAGATGG - Intronic
1100847613 12:98676813-98676835 ATTTTTATCTTTAGTAGAGACGG + Intronic
1100896459 12:99187588-99187610 AAACTGAGCTTTAAAAGTGAAGG + Intronic
1100946655 12:99791403-99791425 AATCTGCACTTTAGAAAAAATGG + Intronic
1102309934 12:111836827-111836849 AATCGTATTTTTAGTAGAGACGG + Intergenic
1102663414 12:114549188-114549210 AAAATGATTTTTAGCAGAGAGGG + Intergenic
1102713543 12:114950093-114950115 AATTTGGTCTATTGAAGAGAGGG + Intergenic
1102761697 12:115391948-115391970 AAACTGTTGTTTAAAAGAGAAGG + Intergenic
1102798372 12:115709516-115709538 AATCTCAACTTCAGAAGGGAAGG - Intergenic
1103105902 12:118224721-118224743 AGTTTGATCTTTAGGAAAGAAGG + Intronic
1103278239 12:119732095-119732117 ATTCAGATATTTAGGAGAGATGG - Intronic
1103755148 12:123199155-123199177 AATTTGATTTTTTGTAGAGATGG + Intronic
1104805917 12:131589129-131589151 AATTTTATCTTTAGTATAGATGG + Intergenic
1106230382 13:27816838-27816860 AAGCTGTCCTTAAGAAGAGATGG - Intergenic
1106753870 13:32801494-32801516 AATCTGAGCTTCAGAAATGATGG + Intergenic
1108297657 13:49040564-49040586 ACTCTGATCTTTAAAATAGTTGG + Intronic
1108443068 13:50476036-50476058 TATCTTCACTTTAGAAGAGAGGG + Intronic
1109371952 13:61434071-61434093 ATTCTGTTCTTTAAAAAAGATGG - Intergenic
1109625261 13:64965637-64965659 CATCTAATTTTTAGTAGAGATGG - Intergenic
1109728223 13:66373701-66373723 AATTTGATCTATATAAGAGTAGG + Intronic
1110194376 13:72769865-72769887 AAACAGATCATTAGAAGATAAGG + Intronic
1110407521 13:75167628-75167650 AATTTTATTTTTAGTAGAGACGG - Intergenic
1110663556 13:78088262-78088284 CATGTGAACTTTGGAAGAGATGG + Intergenic
1111531929 13:89548143-89548165 ATTCTTATTTTTAGTAGAGACGG + Intergenic
1111723666 13:91977632-91977654 AATCTGATTTTAGGAAGAAAAGG - Intronic
1112351775 13:98641309-98641331 TATCTGATCTTTAAAGTAGAAGG - Intergenic
1114726172 14:24940234-24940256 AATCTGGTGTTTAGAAGCAAAGG + Intronic
1115107379 14:29777039-29777061 AAACTAAGCTTTAGAAGTGAAGG + Intronic
1115504064 14:34077556-34077578 AGTCTGGTCTTTAGTAGAGATGG + Intronic
1115633478 14:35268174-35268196 AATCGTATTTTTAGTAGAGATGG - Intronic
1115859621 14:37669490-37669512 AATATTATATTTAGAATAGAAGG - Intronic
1116766230 14:49073527-49073549 AATCTGCTCTATAGAACAAATGG + Intergenic
1119218374 14:72886486-72886508 TTTCTAATCTTTAGTAGAGATGG - Intronic
1119395311 14:74322016-74322038 ATTCTGTTTTTTAGTAGAGACGG + Intronic
1119800959 14:77444752-77444774 AATTTAATTTTTAGTAGAGACGG + Intronic
1120555275 14:85921775-85921797 AATCTGGTCTTTAGCAGTTAGGG + Intergenic
1122300656 14:100729189-100729211 AAACAGATCTTTAGAATACAGGG - Intronic
1122619906 14:103050015-103050037 AATCTTAGCTTTAGAAGTTAAGG - Intronic
1122729826 14:103787820-103787842 AATTTTATTTTTAGTAGAGATGG + Intronic
1126785281 15:52173648-52173670 AATCTCAACTTTCTAAGAGAAGG + Intronic
1126923195 15:53550854-53550876 ATTCTAAGCTTTATAAGAGATGG - Intronic
1127208181 15:56742332-56742354 ATTCTGAGCTCTAGAAGACATGG + Intronic
1127278188 15:57465955-57465977 AAACTGTTCTTTAAAAGATATGG - Intronic
1127504848 15:59588471-59588493 AATCTTATTTTTGGTAGAGATGG + Intergenic
1128179570 15:65589870-65589892 AGTCTGAAGTTTAGGAGAGAGGG - Intronic
1128295931 15:66519665-66519687 AGGCTGGTCTTTAGTAGAGACGG + Intronic
1128610593 15:69070017-69070039 AATCTCATTTGGAGAAGAGATGG - Intergenic
1129372590 15:75106919-75106941 ATTCTTATTTTTAGTAGAGAGGG + Intronic
1131098456 15:89670395-89670417 AAGCTGGGCTTTAGAGGAGAGGG + Intronic
1131747545 15:95465418-95465440 AATCTGTCCTTTAGATGAGAGGG - Intergenic
1133906137 16:10024388-10024410 AATTTTATTTTTAGTAGAGATGG + Intronic
1135580782 16:23624679-23624701 AATTTTATTTTTAGGAGAGACGG + Intronic
1136222999 16:28840627-28840649 AATTTTATTTTTAGTAGAGACGG + Intergenic
1136502492 16:30679593-30679615 AATTTTATTTTTAGTAGAGATGG + Intergenic
1140098367 16:71894414-71894436 AATTTCCTCTTTAGTAGAGACGG + Intronic
1141584674 16:85025708-85025730 AAACTGGTTTTTAAAAGAGAGGG - Intergenic
1142980876 17:3670694-3670716 CATCTTATTTTTAGTAGAGATGG - Exonic
1144106114 17:11987054-11987076 TTTCTCATATTTAGAAGAGACGG + Intronic
1144478138 17:15606746-15606768 TAACTGCTCTTTAGAAGAGATGG - Intronic
1144553096 17:16258669-16258691 AATTTTATTTTTAGTAGAGATGG + Intronic
1144563375 17:16340210-16340232 AATGTGAAGTTAAGAAGAGAGGG + Intronic
1144630061 17:16866796-16866818 GAACTGTGCTTTAGAAGAGATGG + Intergenic
1144651315 17:17009012-17009034 GAACTGTGCTTTAGAAGAGACGG - Intergenic
1144920157 17:18756960-18756982 TAACTGCTCTTTAGAAGAGATGG + Intronic
1145359646 17:22201671-22201693 AATGTGAAGTTAAGAAGAGAGGG + Intergenic
1145967645 17:28931561-28931583 AAGCAGATCTTAAGAAGTGATGG - Intronic
1146111944 17:30097901-30097923 ACTGAGATCTCTAGAAGAGATGG - Intronic
1146505710 17:33403047-33403069 AATCTGATTATTAGTAGAGATGG - Intronic
1147004244 17:37389133-37389155 AATATTTTATTTAGAAGAGATGG + Intronic
1147843751 17:43390673-43390695 AATTTTATTTTTAGTAGAGATGG - Intergenic
1148913250 17:50954635-50954657 GAGCTCATCTGTAGAAGAGAAGG - Intergenic
1149811815 17:59681908-59681930 ATTCTGAATTTTAGAAGAGTTGG + Intronic
1152032655 17:77853716-77853738 AATCTGTTCCTTTGAGGAGAGGG - Intergenic
1152356851 17:79811668-79811690 AATTTGAGATTTTGAAGAGAAGG - Intergenic
1154301035 18:13192735-13192757 AAGCTAATTTTTAGTAGAGATGG + Intergenic
1154984487 18:21535929-21535951 AAACTGATCTTTACATGAAATGG + Intronic
1155591368 18:27430790-27430812 AATCTGTTCTTCAGAAATGAAGG + Intergenic
1155681941 18:28498608-28498630 AATCTGTACTTTACAAGAAATGG - Intergenic
1156724221 18:40108581-40108603 AATTTGCTCTTTTGGAGAGATGG - Intergenic
1156759129 18:40565961-40565983 AAGCTGTTCTTGAGAAGAGCTGG - Intergenic
1157178660 18:45476226-45476248 AAACTAATCTTCATAAGAGAAGG - Intronic
1158272117 18:55727784-55727806 AATATTATTTTTAGTAGAGACGG + Intergenic
1158289966 18:55929456-55929478 AATATGAGCTTTACAAAAGAGGG - Intergenic
1158326796 18:56321581-56321603 TATCTGAAATTGAGAAGAGATGG + Intergenic
1158372352 18:56823212-56823234 AATCTGATATTGAAAAGAGAAGG - Intronic
1158427995 18:57356241-57356263 AATCTAATCCTTAGAAAACATGG - Intronic
1159599282 18:70413357-70413379 AATTTTATTTTTAGTAGAGAAGG - Intergenic
1161973100 19:7594671-7594693 AATTTTATTTTTAGTAGAGACGG + Intergenic
1162408086 19:10487823-10487845 ATTTTGATTTTTAGTAGAGACGG - Intronic
1163424360 19:17232975-17232997 ATTCTTATTTTTAGTAGAGACGG - Intronic
1166034785 19:40160182-40160204 AATTTGATTTTTTGTAGAGATGG - Intergenic
1166407984 19:42536322-42536344 AATCTGAACTATAGAACAAATGG - Intronic
1167753634 19:51396110-51396132 TAGCTGATTTTTAGTAGAGACGG - Intergenic
1167825274 19:51967219-51967241 AATCTGTTCTTTGGACGAAATGG - Intronic
1168611772 19:57806460-57806482 TTTTTGATTTTTAGAAGAGATGG - Intronic
1168619161 19:57863419-57863441 ATTCTTTTCTTTAGTAGAGACGG + Exonic
925671058 2:6310465-6310487 AAGCTGAGATTTTGAAGAGAAGG + Intergenic
925816750 2:7760252-7760274 AATCACATCTTCAGATGAGATGG + Intergenic
926624558 2:15080302-15080324 AATCTGAACTGAAGAAGACAAGG + Intergenic
926762220 2:16288106-16288128 AATCTAATCTCCAGAATAGAAGG - Intergenic
928139577 2:28716963-28716985 AATCTGCACTTTAGAAGGGACGG + Intergenic
928721845 2:34130285-34130307 AATTTTATTTTTAGTAGAGATGG + Intergenic
928835562 2:35540376-35540398 AATCTGTACTTTTGAAGAGGAGG - Intergenic
929080937 2:38121417-38121439 AATCAGACCTTTAGTAGACACGG + Intergenic
929084608 2:38156159-38156181 ACTGGCATCTTTAGAAGAGAAGG + Intergenic
930437655 2:51365469-51365491 AATCTGATATTTCCAAAAGAGGG - Intergenic
930795320 2:55383746-55383768 AATCTGATTTTTCTAAGAGAAGG + Intronic
932696574 2:73961858-73961880 TTTCTGATTTTTAGTAGAGATGG - Intergenic
933208227 2:79534954-79534976 AATCTGATATTGAGTAGGGAAGG + Intronic
933318087 2:80738723-80738745 AATCTAAGCTTTATAAGTGAAGG + Intergenic
934847419 2:97671177-97671199 AATATAATTTTTAGTAGAGATGG + Intergenic
935169664 2:100601236-100601258 TTTCTGATTTTTAGTAGAGACGG + Intergenic
935192189 2:100787054-100787076 AAGCTGATCTCTAGAAGAGAAGG + Intergenic
935509630 2:103955537-103955559 AATTTTATTTTTAGTAGAGACGG - Intergenic
935517059 2:104052883-104052905 AATTTGATATTTAAAAGAAAGGG + Intergenic
935914611 2:107935741-107935763 AAACAGTTCTTTAAAAGAGAGGG + Intergenic
936984840 2:118299099-118299121 AATTTTATTTTTAGTAGAGACGG + Intergenic
937003701 2:118491742-118491764 AAGCGGATCTTTATAAGGGAAGG + Intergenic
939019128 2:136938205-136938227 AATCTGCTGTTTAGAAAGGATGG - Intronic
939282690 2:140085049-140085071 AATGTGATTTTTAGAAGGGAAGG - Intergenic
940588286 2:155685253-155685275 AATCTTATTTTTAGAAAAGGAGG - Intergenic
941360329 2:164543120-164543142 AATTTTATTTTTAGTAGAGATGG - Intronic
941725241 2:168853463-168853485 TAACAAATCTTTAGAAGAGAAGG + Intronic
942209497 2:173656393-173656415 AATCTGATTTTTTGAAAAGTTGG - Intergenic
943174759 2:184456694-184456716 AATTTTATTTTTAGTAGAGACGG - Intergenic
943405304 2:187475883-187475905 AACCTGAGCTTCAGAAAAGAGGG - Intronic
944768183 2:202885887-202885909 AATTTTATTTTTAGTAGAGACGG - Intronic
945101996 2:206270737-206270759 ATTTTTATTTTTAGAAGAGATGG + Intergenic
945630945 2:212275572-212275594 AAACTGAGCTTCATAAGAGAAGG + Intronic
946349118 2:219136771-219136793 TTTCTTATCTTTAGTAGAGATGG + Intronic
946581954 2:221138938-221138960 AATCTAATATTTGGAAGAGAAGG - Intergenic
947188473 2:227475580-227475602 TATCTGATGTTTAGATGACATGG + Intronic
947315154 2:228849417-228849439 AAACATATCTTTGGAAGAGAAGG + Intergenic
947454524 2:230241669-230241691 GATCTGATCTCTTGAATAGATGG + Intronic
947942254 2:234068086-234068108 AAACTGATCTGTACAGGAGAGGG - Intronic
1169614594 20:7426132-7426154 AATCAGAGCTTTCTAAGAGACGG + Intergenic
1169884675 20:10385652-10385674 AATATGTTCTTTAGCAGGGAAGG + Intergenic
1169970522 20:11265181-11265203 AGTCTGATCTTTCCAAGATAGGG - Intergenic
1170012053 20:11734884-11734906 TATTTTATCTGTAGAAGAGAGGG + Intergenic
1172248266 20:33460991-33461013 TTTCTGATCTTTTGTAGAGATGG - Intergenic
1173618389 20:44417799-44417821 AATTTTATTTTTAGTAGAGACGG - Intronic
1174111143 20:48198600-48198622 ATTCTTATTTTTAGTAGAGATGG - Intergenic
1177241371 21:18462952-18462974 AAACTGAGCTTCATAAGAGAAGG + Intronic
1177556470 21:22695690-22695712 AAACTGAGCTTCATAAGAGAAGG - Intergenic
1177581256 21:23024203-23024225 ACACTGATCTTTACAAGACATGG - Intergenic
1177771282 21:25519120-25519142 AACCTGCTCTTTTGAAGGGAAGG + Intergenic
1177847187 21:26304133-26304155 TATCTGATCCTTAGAGGAGAGGG + Intergenic
1177911389 21:27037224-27037246 GATTTAATCTTTAGAAGAGGAGG + Intergenic
1177916935 21:27100679-27100701 TATCTTATCTTGAGAAGAGTGGG + Intergenic
1182085185 22:27556431-27556453 ATTTTGATTTTTAGTAGAGATGG + Intergenic
1182142259 22:27970398-27970420 AATGATATCTTTTGAAGAGAAGG + Intergenic
1182600219 22:31456688-31456710 AATTTTATTTTTAGTAGAGATGG + Intronic
1183405511 22:37628776-37628798 AATCTGACCTAGAGAAGATAAGG - Intronic
1183503087 22:38192932-38192954 AATCTGAGCTTTAGAAGGCAAGG + Intronic
1184416636 22:44355691-44355713 ATTCTGTTCTTTAGAAGATGGGG + Intergenic
1184702093 22:46182014-46182036 AATTTTATTTTTAGTAGAGACGG + Intronic
949377043 3:3401644-3401666 AACCTGTGCTTTAGAAAAGAGGG + Intergenic
949845698 3:8368434-8368456 AATGTGATTTTTACATGAGAGGG + Intergenic
951032842 3:17901941-17901963 AAACTGATCTTTGGAGCAGAAGG - Intronic
951165380 3:19479483-19479505 AATCTCTTCTTTAGATTAGATGG + Intronic
956119158 3:65948629-65948651 AATCTTTTCTTTAAAAGAGAAGG + Intronic
956351029 3:68336892-68336914 TTTCTTATTTTTAGAAGAGATGG + Intronic
956957006 3:74352728-74352750 AATCTGGTTTTTAAAAGTGATGG + Intronic
957166938 3:76686593-76686615 AATATGATCTTGAGAACAAATGG - Intronic
957895756 3:86419595-86419617 GACCTGATCATTAGCAGAGAGGG - Intergenic
958215913 3:90575442-90575464 AAACTGCTCTATAGAAAAGAAGG + Intergenic
958455813 3:94329390-94329412 AATTTTTTTTTTAGAAGAGATGG - Intergenic
958544665 3:95529214-95529236 ACTCTGATCTACAGAAGAAAAGG - Intergenic
958943928 3:100343404-100343426 TATCTAATCTGTAGAAGAGAAGG - Intronic
963366842 3:144345832-144345854 ACTCTAATCTCTGGAAGAGAGGG - Intergenic
963419209 3:145038419-145038441 AATGTTATTTTTAGTAGAGATGG + Intergenic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964062337 3:152538938-152538960 AATCTGGTCTTGAGAAGAGGAGG + Intergenic
964079847 3:152740977-152740999 AATTTGATCTTGAGATGATAGGG + Intergenic
964320659 3:155493554-155493576 ATTCTGATTTTCAGTAGAGACGG + Intronic
964441163 3:156711922-156711944 AATTTTATTTTTAGTAGAGATGG + Intergenic
964822236 3:160783884-160783906 TATCTGATAGTTAGAAGAGATGG + Intronic
964961288 3:162430202-162430224 AATCTGCACTATAGAAGAAATGG + Intergenic
965956790 3:174379706-174379728 TTTCTGATTTTTAGTAGAGATGG - Intergenic
966139080 3:176734316-176734338 ATCCTTATCTTTAGCAGAGAGGG - Intergenic
970898492 4:21131353-21131375 AATCTCTTCTTTAGAAGTCAGGG + Intronic
971052928 4:22881474-22881496 AATATGAGCTTTAAAAGGGATGG - Intergenic
971666414 4:29492242-29492264 AAACTGTTCTTTAGAAGTGAGGG - Intergenic
971707897 4:30071124-30071146 AAACTGATCTTTTGAAAATAAGG + Intergenic
971843233 4:31881897-31881919 AATCTTACTTTGAGAAGAGAAGG + Intergenic
972246272 4:37248023-37248045 AATCTCATCCGTAGAATAGATGG - Intronic
972562996 4:40245363-40245385 TAGCTAATATTTAGAAGAGACGG - Exonic
974150062 4:57995279-57995301 AATTTTATTTTTAGTAGAGAGGG - Intergenic
974609125 4:64192642-64192664 AACCTGTTTTTTAGAAGAAAAGG - Intergenic
975028403 4:69581474-69581496 AAACTGATCTATACAAGAAAAGG + Intergenic
975075007 4:70195675-70195697 AAACTCATCTTTAGAAAAAAAGG - Intergenic
975115025 4:70670784-70670806 CATCTCATCTTTAGAAGACTAGG + Intronic
975914094 4:79302234-79302256 ATTTAGATCTTCAGAAGAGAAGG - Intronic
976315675 4:83656417-83656439 AAAGTGTTCTTTAAAAGAGATGG + Intergenic
976966152 4:91043756-91043778 AATTTTATTTTTAGTAGAGACGG + Intronic
977173947 4:93796719-93796741 AATATTATTTTTAGTAGAGATGG + Intergenic
977807189 4:101315061-101315083 AATCTGATCGTATTAAGAGATGG + Intronic
978569859 4:110125043-110125065 AATCAGAACTTTTGAAAAGAAGG + Intronic
978595834 4:110376041-110376063 ATTTTGTTCTTTAGTAGAGATGG + Intronic
979801225 4:124911991-124912013 AAGCTGTTCTTTAGAAATGAAGG - Intergenic
981163474 4:141527546-141527568 AATCTGTCCTTTAGAAATGAAGG + Intergenic
981341030 4:143621664-143621686 AATATGATCTTTAAAATTGAGGG - Intronic
981707927 4:147680879-147680901 AGTCTGAGGTTCAGAAGAGAAGG - Intronic
982456681 4:155618504-155618526 AATCTGATCTGTATGAGGGAAGG + Intergenic
982480199 4:155899190-155899212 CATCTGTTCTTTAAAAGGGAAGG - Intronic
982510460 4:156275806-156275828 ATTCTGATCTACAGAAAAGATGG + Intergenic
984064944 4:175036282-175036304 ATTCTGTTCTTTTTAAGAGATGG + Intergenic
984516127 4:180742288-180742310 AATTTGATCTTCAGAAGAAAAGG + Intergenic
984537901 4:181000187-181000209 AATTTTATTTTTAGTAGAGACGG + Intergenic
985186682 4:187324918-187324940 AATTTTATTTTTAGTAGAGATGG - Intergenic
985232817 4:187839554-187839576 ATTCTGATCTTTGGAATTGAAGG - Intergenic
985345404 4:188999822-188999844 AAACTGAGCTTCATAAGAGAAGG - Intergenic
986046619 5:4044303-4044325 AACCTGCTCCTTTGAAGAGAAGG + Intergenic
986712355 5:10497275-10497297 AATTTTATTTTTAGTAGAGATGG - Intergenic
987088463 5:14490095-14490117 AATTTTATTTTTAGTAGAGATGG - Intronic
987634983 5:20527655-20527677 AAACTCAGCTTTATAAGAGAAGG + Intronic
988689560 5:33558974-33558996 GCTCTGGTCTTTGGAAGAGAGGG - Intronic
988706579 5:33731925-33731947 AATTTGTTCTTTTGGAGAGATGG + Intronic
990813767 5:59759339-59759361 AATCTCTTCTTAAGAAGACATGG - Intronic
992045692 5:72886724-72886746 CAGCTGATTTTTAGGAGAGACGG - Intronic
992133356 5:73718045-73718067 ATTCTGATTTTTAGTAGAGATGG + Intronic
992612774 5:78521796-78521818 AATCTGCCATTTAGCAGAGATGG + Intronic
992706041 5:79393899-79393921 AATATTTTCTTTATAAGAGATGG - Intronic
993147910 5:84119726-84119748 AATCTTATCTTTAGGATAAATGG + Intronic
993289082 5:86041458-86041480 ATTGAGATCTTAAGAAGAGATGG - Intergenic
994689163 5:102995376-102995398 AATGTGTACTGTAGAAGAGATGG - Intronic
995102159 5:108325443-108325465 AATTTGATCTTAAGAATAAATGG + Intronic
995141051 5:108735674-108735696 AATGGGATCTAGAGAAGAGAAGG - Intergenic
995166822 5:109053211-109053233 AATTTTATTTTTAGTAGAGATGG - Intronic
995280241 5:110326925-110326947 AATTTTATTTTTAAAAGAGATGG + Intronic
995453988 5:112332789-112332811 AATGTGCTTTTTAGAAGATATGG - Intronic
995547209 5:113245119-113245141 AATTTTATTTTTAGCAGAGACGG - Intronic
995578846 5:113573214-113573236 AAACTGAGCTTTATAAGTGAAGG - Intronic
996377226 5:122824027-122824049 ATTTTTATTTTTAGAAGAGACGG - Intronic
996451183 5:123626791-123626813 AATCTGTTCTTTATAAATGAAGG + Intergenic
997558444 5:134822047-134822069 AATTTTATTTTTAGTAGAGATGG + Intronic
997561561 5:134850315-134850337 AATTTTATTTTTAGTAGAGATGG + Intronic
998427957 5:142045899-142045921 CAGCTTATCTTTAGTAGAGATGG + Intergenic
998866644 5:146511140-146511162 AATCTGATCTTTAGAGACAAAGG - Exonic
999082689 5:148858992-148859014 AAACTGATGTGTAGAAGAGAAGG - Intergenic
1000863957 5:166490008-166490030 AATTTTATTTTTAGTAGAGACGG + Intergenic
1002018947 5:176349507-176349529 CAGCTGATTTTTAGTAGAGATGG - Intronic
1002147831 5:177199765-177199787 AATTTAATTTTTAGTAGAGACGG + Intronic
1002971533 6:2027155-2027177 ATTCTGATCTTATGAAGCGAGGG + Intronic
1003110145 6:3246550-3246572 AATCTTATCTTATAAAGAGAGGG - Intronic
1003354454 6:5354053-5354075 AAACTAATCTCTAGATGAGATGG - Intronic
1003480521 6:6527550-6527572 AATTTGTTCTGTAGCAGAGATGG + Intergenic
1003558248 6:7159618-7159640 CATCTCATCTTTACAAGAAAAGG + Intronic
1003685180 6:8295563-8295585 GATCTGCTCTTTAGAGTAGAAGG - Intergenic
1005141438 6:22636374-22636396 ACTATGATTTTTAGAACAGATGG - Intergenic
1005454036 6:26001556-26001578 AATCAGATTTATAGAAGAAAGGG + Intergenic
1008413702 6:51214487-51214509 AGTCTGTTCTTAAAAAGAGAAGG + Intergenic
1008780337 6:55095549-55095571 AATCATATTTTTAGTAGAGACGG + Intergenic
1010629904 6:78186789-78186811 AATCTGAACTATAGAATAAATGG - Intergenic
1010714571 6:79213514-79213536 AATGTGATTTTTAGAACAGTTGG - Intronic
1011164406 6:84430267-84430289 CAACTGATCTTCAGCAGAGAAGG + Intergenic
1011354113 6:86455994-86456016 AATCTGATATTTTTAAAAGAGGG - Intergenic
1012262488 6:97103588-97103610 AATTTTATTTTTACAAGAGATGG + Intronic
1012304996 6:97644483-97644505 AATTAGATCTTTACTAGAGAGGG - Intergenic
1012639102 6:101586696-101586718 AATTTTATTTTTAGTAGAGATGG - Intronic
1012691043 6:102311658-102311680 AATCTCATCTTTTGATGGGAGGG - Intergenic
1013494200 6:110681629-110681651 AATCTGATTTTGCCAAGAGATGG - Intronic
1013661054 6:112297396-112297418 AATTTCATCTATGGAAGAGACGG + Intergenic
1014290262 6:119550311-119550333 AAACTGATCATTAGAACAAATGG - Intergenic
1016157193 6:140825212-140825234 AATATGATCTGTAGAAGTGGAGG - Intergenic
1018451136 6:163908487-163908509 AATCAGATGTTTTGAAGAAAAGG - Intergenic
1018796366 6:167188301-167188323 TATTTTATTTTTAGAAGAGATGG - Intronic
1019902678 7:4035153-4035175 TTTCTTATCTTTAGTAGAGATGG + Intronic
1020286210 7:6683073-6683095 AATCTGCTCATTAGCAGAAAGGG + Intergenic
1023031656 7:36094962-36094984 AAGCAGGTCTTTAGAAGTGAGGG + Intergenic
1023357092 7:39378150-39378172 ATTCTCATCATTATAAGAGATGG - Intronic
1024879666 7:54071022-54071044 AATCTGATCATTGGAATGGAGGG - Intergenic
1026115355 7:67491224-67491246 AATTTTATTTTTAGTAGAGATGG + Intergenic
1026226585 7:68447366-68447388 AGTCTGATCGTCAGAAGAGGTGG - Intergenic
1026444005 7:70468378-70468400 AACATGATCTTTAGAAGGAAAGG + Intronic
1026638616 7:72105713-72105735 AAGCTGTTATTTAGAAGAGGAGG + Intronic
1026653991 7:72240643-72240665 ACCCTCATCTTCAGAAGAGAAGG + Intronic
1027855575 7:83507169-83507191 AATATGATCTTTAAAATAGTTGG + Intronic
1028456755 7:91046593-91046615 GGTCTGATTTTTATAAGAGAAGG + Intronic
1029782204 7:102746304-102746326 AAGCTAATTTTTAGCAGAGATGG + Intergenic
1030237186 7:107276697-107276719 AATGTGACCTTTAGAAGAAAAGG - Intronic
1031415784 7:121495169-121495191 AACCTCATCTGTAGCAGAGAGGG + Intergenic
1031534879 7:122921064-122921086 AATCTGGTAATTAGCAGAGATGG - Intergenic
1031541748 7:123003672-123003694 CATAGGATCTTTAGAGGAGAAGG - Intergenic
1032830508 7:135620361-135620383 TTTCTGATTTTTAGTAGAGATGG - Intronic
1033624009 7:143090165-143090187 AAACTGAGCTTTATAAGTGAAGG + Intergenic
1034136743 7:148777893-148777915 AATTTTATCTTTAGTAGAGACGG - Intronic
1034538602 7:151741505-151741527 AATTTTATTTTTAGTAGAGATGG - Intronic
1036045383 8:5134351-5134373 AATATAATCTCTAGAGGAGAGGG + Intergenic
1036278838 8:7380847-7380869 AATTTTGTCTTTAGTAGAGATGG - Intronic
1036342681 8:7931021-7931043 AATTTTGTCTTTAGTAGAGATGG + Intronic
1036693978 8:10962791-10962813 AATTTTATTTTTAGTAGAGATGG + Intronic
1036759305 8:11496411-11496433 AATCTTATTTTTTGAAGAGATGG + Intronic
1037217244 8:16470921-16470943 AATATGTTTTTTAAAAGAGATGG - Intronic
1038658403 8:29475074-29475096 AATCTGCTCCTTAGAAGGGGTGG - Intergenic
1038661121 8:29497842-29497864 ATTCTGATCTTTTGAAGGGGTGG + Intergenic
1039167770 8:34704535-34704557 AAATTGATCTTTAAAAGATATGG - Intergenic
1039456356 8:37710034-37710056 TCTATGGTCTTTAGAAGAGAGGG - Intergenic
1039541861 8:38379056-38379078 AATCTGATCAGTGTAAGAGACGG + Intronic
1039874485 8:41574015-41574037 AATTTTATTTTTAGTAGAGATGG - Intergenic
1039989575 8:42476273-42476295 AATTTTATTTTTAGTAGAGACGG + Intronic
1040366847 8:46726211-46726233 ATTCTGATCTTTAGAAACAAAGG + Intergenic
1041615492 8:59901114-59901136 AAGCTAAGCTTTATAAGAGAAGG + Intergenic
1042389098 8:68212369-68212391 AATTTGATCATCAAAAGAGATGG + Intronic
1042656034 8:71097532-71097554 GATCTGAGCTTTAGAAGAATTGG - Intergenic
1043072649 8:75658172-75658194 ATTCTCAACTTTAGATGAGAAGG + Intergenic
1043157022 8:76795708-76795730 AATCTTGTTTTTAGTAGAGACGG + Intronic
1043924237 8:86018640-86018662 AATTTGATTTTTTTAAGAGATGG - Intronic
1044235190 8:89822494-89822516 AATCTGACTACTAGAAGAGAAGG - Intergenic
1046344896 8:112910552-112910574 AATCTGAGATTCAGAATAGAGGG - Intronic
1046460541 8:114528483-114528505 AATGAGATCTTTAAAACAGACGG + Intergenic
1046526977 8:115393266-115393288 AAATTGATCTTTAGTAGAAATGG - Intergenic
1047246146 8:123146845-123146867 CAGCTAATCTTTAGTAGAGATGG + Intronic
1047272921 8:123379738-123379760 AATTTTATTTTTAGTAGAGATGG + Intronic
1047531042 8:125675454-125675476 AAACTCATCTTTAGAAGGAAGGG - Intergenic
1049517743 8:143070655-143070677 TATTTTATCTTTAGTAGAGATGG + Intergenic
1050139205 9:2499952-2499974 AATGTGATCTTTAGAAAAGAGGG + Intergenic
1050214738 9:3309888-3309910 ATTCTGAGATTTAGAGGAGACGG + Intronic
1050380408 9:5022031-5022053 ATTCTGATATATAGAAGAGGTGG - Exonic
1053394448 9:37760153-37760175 AATTTTATTTTTAGTAGAGACGG - Intronic
1053480576 9:38413672-38413694 AAACTGGTCTTTAGAAGATTTGG + Intronic
1054795838 9:69301106-69301128 AATTTTATTTTTAGTAGAGACGG - Intergenic
1055736325 9:79334856-79334878 AAACTGAGCTTTATAAGCGAAGG - Intergenic
1056313532 9:85367031-85367053 AATCTGGTTTTTAGAAGACATGG - Intergenic
1057014725 9:91641893-91641915 ATTCAGATCTTCAAAAGAGATGG + Intronic
1057344181 9:94233405-94233427 TATCAGAGTTTTAGAAGAGAGGG + Intergenic
1058032171 9:100212451-100212473 GACCTGAACATTAGAAGAGATGG - Intronic
1058626604 9:106939868-106939890 AATCAGCTGCTTAGAAGAGAAGG + Intronic
1059032012 9:110708217-110708239 AATTTGATCTCTAGGAAAGAAGG - Intronic
1059313594 9:113405593-113405615 AATTTTATTTTTAGTAGAGATGG - Intergenic
1059516088 9:114897069-114897091 ATTTTGATTTTTAGTAGAGACGG + Intronic
1060837929 9:126771410-126771432 GATTAGATCTTTAAAAGAGAGGG + Intergenic
1060913064 9:127366211-127366233 AAGCTAATTATTAGAAGAGAAGG + Intronic
1185480981 X:446076-446098 AATCTCATTTTCAGAAAAGAAGG + Intergenic
1185769537 X:2755071-2755093 ATTCTGATTTTCAGAAGACAAGG - Intronic
1186986668 X:15022222-15022244 AATATCATATTTAGTAGAGATGG - Intergenic
1188041486 X:25374819-25374841 TCTCTGATCTTTTGAAGAGGTGG + Intergenic
1188737367 X:33735037-33735059 AAACTGATCTTGAGAAGCAAGGG - Intergenic
1190379571 X:49827236-49827258 CATCTTATCTGTAGGAGAGAGGG + Intergenic
1190455075 X:50619106-50619128 AATCCGTTCTTCAGAAGAAAAGG - Intronic
1191064060 X:56329238-56329260 AAACTAAGCTTTAGAAGTGAAGG - Intergenic
1193406119 X:81104587-81104609 AAACTAATCTTTATAAGTGAAGG - Intergenic
1193587101 X:83337666-83337688 AATGTGTTCTTTAGAAACGATGG + Intergenic
1194036569 X:88881666-88881688 AATCTGTGCTTTAGAAATGAAGG - Intergenic
1194233394 X:91351768-91351790 AATCTGATCTTTAACAAAGTTGG + Intergenic
1194370671 X:93067119-93067141 AAACTGATCTTTATAAACGAAGG + Intergenic
1194489831 X:94531795-94531817 AATCTAAGCTTTATAAGTGAAGG + Intergenic
1195308166 X:103606288-103606310 ATCCAGATATTTAGAAGAGAAGG + Intergenic
1195619000 X:106934654-106934676 AAACTCATTTTTAGTAGAGATGG + Intronic
1195665876 X:107429863-107429885 TTTTTGATCTTTAGTAGAGATGG - Intergenic
1196832375 X:119785942-119785964 AATTTTATTTTTAGTAGAGATGG - Intergenic
1197191290 X:123650202-123650224 AAACTAAGCTTTATAAGAGAAGG + Intronic
1199354575 X:146846917-146846939 AATAAGATATTTAGAAAAGATGG - Intergenic
1199441286 X:147870534-147870556 AATCTGACCTATAGAATAAATGG + Intergenic
1200678462 Y:6179009-6179031 AAACTGATCTTTATAAACGAAGG + Intergenic
1201300971 Y:12504558-12504580 ATTCTGATTTTCAGAAGACAAGG + Intergenic
1201376352 Y:13324939-13324961 AATGTAATTTTTAAAAGAGAGGG - Intronic
1201783501 Y:17747631-17747653 AAACTAATCTTTATAAGTGAAGG + Intergenic
1201818052 Y:18158356-18158378 AAACTAATCTTTATAAGTGAAGG - Intergenic
1202031317 Y:20577115-20577137 ACTCTGATCTTTAGAGCTGATGG - Intronic
1202047729 Y:20751339-20751361 AATTTTATTTTTAGTAGAGATGG + Intergenic
1202344710 Y:23909202-23909224 ATTCTTATTTTTAGTAGAGAGGG + Intergenic
1202526058 Y:25760881-25760903 ATTCTTATTTTTAGTAGAGAGGG - Intergenic