ID: 924081396

View in Genome Browser
Species Human (GRCh38)
Location 1:240401859-240401881
Sequence GGTTTACTCACTTGTAATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924081396_924081407 28 Left 924081396 1:240401859-240401881 CCAGAATTACAAGTGAGTAAACC 0: 1
1: 0
2: 0
3: 20
4: 230
Right 924081407 1:240401910-240401932 CCACTTCGTCATATGTAAAAAGG 0: 1
1: 0
2: 11
3: 258
4: 1682
924081396_924081399 2 Left 924081396 1:240401859-240401881 CCAGAATTACAAGTGAGTAAACC 0: 1
1: 0
2: 0
3: 20
4: 230
Right 924081399 1:240401884-240401906 AGAAAGTTCCCCAAGTTCCCGGG 0: 1
1: 0
2: 1
3: 18
4: 208
924081396_924081398 1 Left 924081396 1:240401859-240401881 CCAGAATTACAAGTGAGTAAACC 0: 1
1: 0
2: 0
3: 20
4: 230
Right 924081398 1:240401883-240401905 CAGAAAGTTCCCCAAGTTCCCGG 0: 1
1: 0
2: 3
3: 20
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924081396 Original CRISPR GGTTTACTCACTTGTAATTC TGG (reversed) Intronic
900034816 1:398367-398389 GGTTTTCTCACTTGTAAATGGGG - Intergenic
902108308 1:14056538-14056560 GATTTATTCTCTTATAATTCTGG - Intergenic
903319654 1:22534941-22534963 GGTTTCCTCATCTGTAATGCAGG - Intergenic
903365637 1:22804058-22804080 TGTTTTCTCACTTGTAAGACGGG - Intronic
903577692 1:24349062-24349084 GGTTTCCTCACTTGTAAAATGGG - Intronic
904060189 1:27703176-27703198 GGTTAATTCACCTGTAGTTCTGG + Intergenic
904914219 1:33958234-33958256 AGTTTCCTCACTTGTAAATGAGG + Intronic
905194452 1:36264298-36264320 TGTTTACTCACTTGTGTGTCAGG + Intronic
905812598 1:40923509-40923531 GGTTTCCTCACTTGTAACATGGG + Intergenic
906011565 1:42531917-42531939 GGTTTTCTCATGTGTAAATCAGG - Intronic
907690578 1:56660746-56660768 AGTTTGCTCACTTGTAAATAGGG + Intronic
908595882 1:65688300-65688322 GGTCTTCTCACTTGCAATTCAGG + Intergenic
908657984 1:66407965-66407987 GGTTTCCTCACTTGAAACTATGG + Intergenic
909176995 1:72373463-72373485 GCTTTACTCACTTTTAAAACCGG - Intergenic
913195575 1:116453728-116453750 TGTTTACTCACTTGTAAAGTAGG - Intergenic
914264407 1:146026096-146026118 GTTTTACTTATTTTTAATTCTGG - Intergenic
914597911 1:149172448-149172470 TCTTTACTTACTTGTAAGTCTGG - Intergenic
914880826 1:151545428-151545450 AGTTTTCTCACTTGTAAAACTGG + Intronic
916155137 1:161837919-161837941 GGTTTCCTCATCTGTAAATCAGG - Intronic
916399021 1:164425588-164425610 GGGTTACTGACTTATAATCCTGG - Intergenic
917592868 1:176495224-176495246 GGTTTACTCTTTTATAAATCAGG + Intronic
919287863 1:195587886-195587908 CATTGACTCACTTGTCATTCAGG - Intergenic
921237539 1:213149394-213149416 CATTTACTCACTGGTCATTCAGG + Intronic
921886602 1:220313637-220313659 TGTTTACTCCCTTGTGATGCCGG + Intergenic
922257344 1:223903925-223903947 GGTTTTCTCACTTATAAATGGGG - Intergenic
924081396 1:240401859-240401881 GGTTTACTCACTTGTAATTCTGG - Intronic
924338537 1:243006700-243006722 GGTTTTCTCACTTGTAAATGGGG - Intergenic
924575304 1:245275665-245275687 GTTTAAATCACTTTTAATTCTGG - Intronic
924721529 1:246627464-246627486 GGTTTACTCCCTTGTTTTGCTGG - Intronic
1064618303 10:17186606-17186628 GGTTTATTATCTTATAATTCTGG - Intronic
1068963616 10:62889954-62889976 AGTTTACTCATCTGTAATTTGGG - Intronic
1069331690 10:67300687-67300709 GGTGTACTCACCTGGAATTTAGG - Intronic
1069855265 10:71436907-71436929 GGTTTCTCCACTTGTAAATCAGG + Intronic
1070621930 10:78019514-78019536 GGTTTCCTCACTGGTAAAACGGG + Intronic
1070640056 10:78161811-78161833 AGTTTGCTCACCTGTAATGCGGG + Intergenic
1072464982 10:95655235-95655257 TGTTTCCTCACTTATAAATCAGG + Intronic
1072466569 10:95668673-95668695 GGTTTATTCTCTTGTATTTATGG - Intronic
1073013909 10:100382962-100382984 GGTTTCCTCACCTGGAACTCTGG - Intergenic
1074639079 10:115358643-115358665 GGTTTACTCATTTGTAAAATAGG - Intronic
1076813980 10:132905468-132905490 GGTTTACTTCCTTGTTTTTCTGG + Intronic
1078114022 11:8426747-8426769 GGTTTACTCTGTTAAAATTCTGG + Intronic
1078691887 11:13589700-13589722 TATTGACTCACTTGTCATTCAGG - Intergenic
1079136932 11:17780680-17780702 GGTTTAATCACTTCAAATACTGG - Intronic
1081471812 11:43380826-43380848 GGTTTTATCACTTGTAAATTTGG + Intronic
1083484157 11:62972763-62972785 GATTTGTTCTCTTGTAATTCTGG + Intronic
1083680098 11:64347725-64347747 AGTTTTCTCACTTGTAAAACTGG + Intronic
1085851857 11:80130020-80130042 AGTTTCCTCACTTGTAAAACAGG + Intergenic
1085878315 11:80435387-80435409 AGTTTACTCAGTTGTAAATGGGG + Intergenic
1087757539 11:102070794-102070816 CATTTACTCACTGGTCATTCAGG + Intronic
1087774992 11:102248841-102248863 GTTTTATTAAGTTGTAATTCTGG - Intergenic
1087984696 11:104663477-104663499 GGATTGCTCAATTGTAGTTCAGG + Intergenic
1088744653 11:112795420-112795442 GGTTTCCTCATCTCTAATTCAGG + Intergenic
1088802117 11:113315520-113315542 GGTTTACTGACTTGAAATCTCGG + Intronic
1088870176 11:113884063-113884085 GGTTTCCTCACTTGTAAAGCAGG - Intergenic
1090345600 11:126067186-126067208 AGTTTTCTCATTTGTAATTTGGG - Intergenic
1090740573 11:129656145-129656167 GGTTTACTCAAAAGTCATTCAGG - Intergenic
1093335770 12:17903320-17903342 TATTTACTCAGTAGTAATTCAGG + Intergenic
1094154228 12:27320710-27320732 AGTTTCCTCACTTGTAAGACAGG - Intronic
1096194421 12:49640645-49640667 TGTTTGCTCACCTGTAAATCAGG + Exonic
1096836646 12:54355529-54355551 GGCTTTCTCACTTGGAATGCAGG + Intergenic
1098405184 12:70117533-70117555 GGTTTTCTCATTTGTAATGTGGG + Intergenic
1101601965 12:106217563-106217585 GGCTCACACACTTGTAATCCCGG - Intergenic
1102150619 12:110687372-110687394 GACATACTCCCTTGTAATTCAGG - Intronic
1103583935 12:121937112-121937134 GATTTACTCTCTTGCAGTTCTGG + Intronic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1107059781 13:36146930-36146952 GGTTTCCTCATTTGTAAAACTGG - Intergenic
1107312235 13:39091650-39091672 GGTTTAATCATTTGTATATCAGG - Intergenic
1108028984 13:46208461-46208483 GGTTTCCTCATTTGTAAAACTGG - Intronic
1109186363 13:59273409-59273431 GTTTTTCTCACTTGTATTTTAGG - Intergenic
1109554940 13:63960812-63960834 TGTTTAGTCACTGGTATTTCAGG + Intergenic
1110039830 13:70739819-70739841 GGTTTTCTCATTTGTAAATGTGG - Intergenic
1111170998 13:84526652-84526674 AGTTTCCTCATTTGTAATACAGG + Intergenic
1114421069 14:22583155-22583177 GATTTACTAATTTGGAATTCGGG + Intronic
1117470963 14:56044279-56044301 GGTTTACTCACCTGGAAAGCAGG - Intergenic
1120033958 14:79674447-79674469 GGTTTACTCATCTGTAAATGAGG - Intronic
1120896950 14:89541847-89541869 GGTTTCCTTACTTGTAAAACTGG + Intronic
1121212816 14:92221741-92221763 GGTTTGCTCACTTCTGTTTCTGG - Intergenic
1126717034 15:51528998-51529020 CATTGACTCACTTGTCATTCAGG - Intronic
1126846048 15:52761359-52761381 GGTTTTCTGACTTGTATTTTAGG - Intronic
1127934521 15:63624057-63624079 GGTTTCCTCACTTCTAAGGCAGG - Intronic
1135968239 16:27053049-27053071 AGTTTCCTCAACTGTAATTCAGG + Intergenic
1137433910 16:48440221-48440243 GGTGCACTCACCTGTAATCCTGG - Intronic
1139222289 16:65195816-65195838 TGTTTCCTCACCTGTAATTTGGG + Intergenic
1142143158 16:88481493-88481515 GGTTTACTCACCTGTAAAGTGGG + Intronic
1145114756 17:20198837-20198859 GGTTTCCTCCCTTGTTTTTCTGG + Intronic
1149738729 17:59022564-59022586 GGTTTCCTCATCTGTAAATCTGG + Intronic
1150597961 17:66623819-66623841 GGATGCCTCACTTGTCATTCAGG - Intronic
1152700867 17:81818386-81818408 TGTTTCCTCACTTGTAAATTGGG + Intergenic
1156709943 18:39930649-39930671 GGTGGACTCTCTTCTAATTCTGG - Intergenic
1157067031 18:44364243-44364265 TATTTACTCAGTTGTCATTCAGG + Intergenic
1159858820 18:73621484-73621506 TGTTTACTCAAAAGTAATTCAGG - Intergenic
1161917402 19:7239142-7239164 GCTTTTCTCACTTGAAATTGTGG - Intronic
1162135301 19:8551659-8551681 GGTTTCCTAATTTGTAACTCAGG + Intronic
1163304263 19:16467905-16467927 GGTTTCCTCACTTGTAAAAGGGG + Intronic
1163401108 19:17093388-17093410 GGTTTACGCACTTCTAATCCAGG - Intronic
1163653290 19:18531466-18531488 TGTTTACTCACCTGAAATCCAGG - Intergenic
1165523688 19:36333914-36333936 GCTTGACTCACTTGTAATCAAGG + Intergenic
1165599579 19:37042460-37042482 GGTTTACTTACATTTAGTTCTGG - Intronic
1168014765 19:53563759-53563781 GGTTTCCTCACTGGTAAAGCTGG - Intronic
926457887 2:13091446-13091468 AGTTTATTCTCTTGTAGTTCTGG + Intergenic
926946897 2:18198212-18198234 GGTTTTCTCACTTGTAAAATGGG + Intronic
927213114 2:20650835-20650857 GGTTTCCTCATCTGTAAATCGGG + Intronic
927241628 2:20924532-20924554 GGTTTTCTCATTTGTAAGTTGGG + Intergenic
928384536 2:30854541-30854563 CATTGACTCACTTGTCATTCAGG - Intergenic
929816860 2:45239294-45239316 AGTTTCCTCACTTGTAAATGCGG - Intergenic
931172777 2:59822311-59822333 GGTACATTCATTTGTAATTCTGG - Intergenic
931782181 2:65588357-65588379 GGTTTATTCTCTTACAATTCTGG + Intergenic
932209124 2:69913419-69913441 GCTTTACTCATTTGTATTTTGGG + Intronic
932535148 2:72584899-72584921 TGTTTACTCAAAAGTAATTCAGG - Intronic
932681749 2:73831916-73831938 GGTTTTCTGACTCCTAATTCAGG + Intronic
934568579 2:95354092-95354114 GGTTTCCTCACCTGTAAGTGAGG + Intronic
935478341 2:103553883-103553905 TGTTTTCTCACTAGTCATTCAGG + Intergenic
935832972 2:107019614-107019636 AGTTTCCTCAATTGTAATTTGGG + Intergenic
937617882 2:123947692-123947714 CATTGACTCACTGGTAATTCCGG - Intergenic
937995749 2:127693397-127693419 TCCTTACTCACTTATAATTCTGG + Intergenic
938002815 2:127758434-127758456 GGTTTACTCATTTGTAAAATGGG + Intronic
938379131 2:130826870-130826892 TGTTTACTCACCTGTAAAACAGG - Intergenic
938708961 2:133958778-133958800 GGTTGAGTCACCTGGAATTCAGG + Intergenic
939106943 2:137960104-137960126 GGTTTTCTCATTTGTAATAGGGG + Intergenic
939811911 2:146843150-146843172 GGTTTACACATTTGTATTTCAGG + Intergenic
940577406 2:155528114-155528136 TGTTTATTCACTTATAATCCAGG + Intergenic
943966753 2:194344483-194344505 TGTTTACACCCTTTTAATTCTGG - Intergenic
943987519 2:194641666-194641688 TGTTTACTCAGTAGTCATTCAGG - Intergenic
944563029 2:200960654-200960676 AGTTTACTCATTTGTAAGTTGGG - Intronic
944635228 2:201669874-201669896 GGTTTATTCTCTAGAAATTCAGG + Intronic
945372994 2:209044127-209044149 GGTTTTCTCCCCTATAATTCTGG + Intergenic
947809207 2:232990181-232990203 GGCTGAATTACTTGTAATTCTGG - Intronic
948802756 2:240440324-240440346 GGTTTACTCATTTGTAAAACAGG - Intronic
1169940332 20:10930212-10930234 TATTTACTCACTAGTCATTCAGG - Intergenic
1170474253 20:16699381-16699403 AGTTTCCTCATTTGTAAATCTGG - Intergenic
1176342411 21:5710545-5710567 GGTGGTCTCACTTGTAATTGTGG + Intergenic
1176474665 21:7142697-7142719 GGTGGTCTCACTTGTAATTGTGG + Intergenic
1176502416 21:7613911-7613933 GGTGGTCTCACTTGTAATTGTGG - Intergenic
1176536732 21:8108614-8108636 GGTGGTCTCACTTGTAATTGTGG + Intergenic
1177712753 21:24801354-24801376 GATTTAATTACTTTTAATTCAGG - Intergenic
1178744161 21:35231604-35231626 GGTTTTCTCACTTGTAAAATGGG - Intronic
1183472684 22:38017902-38017924 GGTTTCCTCACTTGTAAAATGGG + Intronic
950489981 3:13298418-13298440 GGTTTCCTCATTTGTAATAAAGG - Intergenic
951435130 3:22653926-22653948 GATTTACCCACTGGTCATTCAGG + Intergenic
951704549 3:25530389-25530411 AGTTTACTATCTTGTAGTTCTGG + Intronic
955575939 3:60363525-60363547 GGTTTACTCACCTGTAAAACAGG - Intronic
959161210 3:102726377-102726399 GTTTTTCTCACTTGTAATCAAGG - Intergenic
959791722 3:110369398-110369420 GGCTTGCTAACTTGTAAGTCGGG - Intergenic
960019757 3:112935476-112935498 TCTTTACTCATTTGTCATTCAGG - Intronic
960205862 3:114897146-114897168 TGTTTACTCATTTGTAAAACTGG - Intronic
965235950 3:166123284-166123306 GCATTATTTACTTGTAATTCTGG + Intergenic
965380765 3:167984785-167984807 CATTTACCCACTTGTCATTCAGG - Intergenic
967293720 3:187945821-187945843 GACTTACTCACCAGTAATTCAGG - Intergenic
968881824 4:3304570-3304592 GGTTTCCTCATTTGTAAAACGGG + Intronic
969834667 4:9830934-9830956 GGTTTCCTCACCTGTAAAACAGG - Intronic
972960128 4:44444644-44444666 GGTTTCCTCACCTGTATTACAGG - Intronic
974513368 4:62874601-62874623 CGTTGACTCACTGGTCATTCAGG - Intergenic
977768612 4:100830433-100830455 GTTTTACTCACTTGCATTTCAGG - Intronic
979238582 4:118428535-118428557 GGTTTTCTCACTTGTAAATGGGG + Intergenic
980261691 4:130457643-130457665 GATTTACCCAGTGGTAATTCAGG + Intergenic
982129057 4:152210607-152210629 TATTTACTCACAAGTAATTCAGG - Intergenic
982467956 4:155753864-155753886 AGTTTCCTCACTTGTAAAACAGG - Intergenic
982480251 4:155900107-155900129 CGTTTGCTCAGTTGTAATTATGG - Intronic
983091823 4:163512867-163512889 GGTTTACTTATTTGAAACTCTGG + Intronic
983506549 4:168559078-168559100 TGTTAAGTCATTTGTAATTCAGG - Intronic
983683683 4:170382405-170382427 CATTGACTCACTTGTTATTCAGG + Intergenic
985542504 5:493461-493483 TGTTTTCTCCCTTGTAATTACGG + Intronic
986999406 5:13644378-13644400 GGTTTACTCAGCTGGAATGCAGG - Intergenic
987899368 5:23991387-23991409 GGTTTAGTCAATGGAAATTCAGG - Intronic
988219931 5:28331439-28331461 TGTTTACTCAAATGTCATTCAGG + Intergenic
989294634 5:39809309-39809331 TGGTTACTGACTTCTAATTCTGG - Intergenic
989981574 5:50652224-50652246 TCTTTACTCACCTGTAAGTCTGG - Intergenic
993134810 5:83946502-83946524 GGTTAACTCTCTTGTGATGCTGG + Intronic
993415007 5:87616421-87616443 GTTTTACTCATTTGAAATTCTGG - Intergenic
994015318 5:94958157-94958179 TATTTACTCATTTGTCATTCAGG - Intronic
994205249 5:97027600-97027622 GGTTTCCTCAGTTGCAGTTCCGG + Intronic
995713083 5:115054363-115054385 GGTTTCCTCAGTTGTGATACAGG - Intergenic
1001305697 5:170570940-170570962 AGTTTCCTCACTTATAAATCAGG - Intronic
1001400637 5:171444365-171444387 GGTTTTCTCACCTGTAAATTGGG + Intronic
1002739003 5:181420504-181420526 GGTTTTCTCACTTGTAAATGGGG + Intergenic
1003437699 6:6108159-6108181 TGTTAACTCACTGGTCATTCAGG + Intergenic
1006012163 6:31052000-31052022 GGATTACACACCTGTAATCCCGG + Intergenic
1006615962 6:35327091-35327113 AGTTTCCTCACTTGTAAATGGGG + Intergenic
1007862957 6:44933530-44933552 GGTTTCCTCACCTGTAAATTGGG + Intronic
1008118818 6:47586419-47586441 GTTTTACTTACCTGTAATTGGGG + Intronic
1008157110 6:48029917-48029939 TCCTTACTCACTTGTAATGCTGG - Intronic
1008312484 6:49993321-49993343 CATTGACTCACTGGTAATTCAGG - Intergenic
1008668955 6:53747003-53747025 GGTTTACTTACCTGTAAGTATGG + Intergenic
1008923008 6:56862414-56862436 GCTTTTCTCACTTCTCATTCTGG - Intronic
1009048637 6:58255131-58255153 GGTTTACACGCTTGTAATATTGG + Intergenic
1010673578 6:78716076-78716098 GGTCTACTAAGTTATAATTCTGG + Intergenic
1011901672 6:92305806-92305828 CATTGACTCACTGGTAATTCAGG - Intergenic
1011922608 6:92599485-92599507 GGTTTACTCAAAAGTCATTCAGG - Intergenic
1011980764 6:93374758-93374780 GGTTTCCTCATCTGTAATACAGG + Intronic
1014005108 6:116409056-116409078 AGTTTCCTCATTTGTAATTTGGG + Intronic
1019244112 6:170696056-170696078 GGTTTTCTCACTTGTAAATGGGG + Intergenic
1019266890 7:122195-122217 TGTTTGCTTACTTGTTATTCAGG - Intergenic
1021306380 7:19037485-19037507 TATTTACTCACTGGTCATTCAGG + Intronic
1022684205 7:32579989-32580011 AGTTTCCTCACTTGTAAAACAGG - Intronic
1023059969 7:36317315-36317337 GGTTTATTTACTTGGAATTTTGG + Intergenic
1023344645 7:39259289-39259311 TGTTTACTCAGATGTAATCCTGG + Intronic
1024146291 7:46520800-46520822 AATTTACTCACTTTTAAGTCAGG + Intergenic
1025997367 7:66536495-66536517 GGTTTGCTGACTTGGCATTCAGG + Intergenic
1026385039 7:69838429-69838451 AGTTTCCTCACTTGTAAAACAGG - Intronic
1026426952 7:70304265-70304287 AGTTTCCTCACTCATAATTCTGG - Intronic
1026780670 7:73264886-73264908 GTTTTACTCATTTCAAATTCAGG + Intergenic
1026809270 7:73448652-73448674 AGTTTACCCACTGGGAATTCTGG + Intronic
1027021529 7:74818328-74818350 GTTTTACTCATTTCAAATTCAGG + Intronic
1027066497 7:75127607-75127629 GTTTTACTCATTTCAAATTCAGG - Intronic
1028284397 7:88977980-88978002 CGTTGACTCAGTTGTCATTCAGG + Intronic
1028902371 7:96115927-96115949 GGTTTCCTCATTTGTAACACAGG + Intergenic
1030692424 7:112549579-112549601 GTTTTCCTCAGTTGTTATTCTGG - Intergenic
1034279469 7:149842702-149842724 GGTTAAAACACTTGTGATTCAGG - Intronic
1035504013 8:112104-112126 GGTTTTCTCACTTGTAAATGGGG - Intergenic
1036521764 8:9498751-9498773 GATTTACTTATTTGTAAATCTGG - Intergenic
1038180098 8:25219505-25219527 GGTTTACTTATTTGTTTTTCTGG + Intronic
1038604963 8:28991973-28991995 GGTTTTCTCATTTGTAACTGAGG - Intronic
1042440728 8:68822686-68822708 GGTTTATTCAGGTGAAATTCAGG + Intergenic
1043235526 8:77860973-77860995 TATTGACTCACTTGTCATTCAGG - Intergenic
1043359819 8:79459194-79459216 GTTTTACTCATTTGTAAATTGGG - Intergenic
1046055659 8:109075102-109075124 GGTTTACTCATTTGCAAGTTTGG + Intergenic
1047186855 8:122641203-122641225 AGTTTACTCATTTGTAAATGGGG + Intergenic
1047336122 8:123938349-123938371 GATTTACTCCCTTTTCATTCAGG + Intronic
1048299690 8:133242298-133242320 AGTTTCCTCACCTGTAATACAGG + Intronic
1050852342 9:10303150-10303172 TGTTTACTCAGTAGTCATTCAGG - Intronic
1053552710 9:39101080-39101102 GATTTTCTCACTTGTAATCTTGG - Intronic
1053816825 9:41921244-41921266 GATTTTCTCACTTGTAATCTTGG - Intronic
1054085635 9:60740972-60740994 GGTATAGTTACTTGTAACTCTGG + Intergenic
1054107084 9:61064926-61064948 GATTTTCTCACTTGTAATCTTGG - Intergenic
1054613773 9:67266199-67266221 GATTTTCTCACTTGTAATCTTGG + Intergenic
1055382862 9:75727973-75727995 GGTTTACTTCCCTGTAGTTCAGG - Intergenic
1055634210 9:78258905-78258927 GGTGTGCTCACTTATACTTCCGG - Intronic
1056017040 9:82400751-82400773 GGTTTACTCACTTGTCTTGCAGG - Intergenic
1059032515 9:110714315-110714337 GTTTTTCTCACTTGTAAATATGG - Intronic
1059463538 9:114450678-114450700 GGTTTCCTCATTTGTAAAGCTGG - Intronic
1060125316 9:121039097-121039119 AGTTAACTCACTTGTAAAACAGG + Intronic
1203458001 Un_GL000220v1:8100-8122 GGTGGTCTCACTTGTAATTGTGG + Intergenic
1203604302 Un_KI270748v1:45280-45302 GGTTTTCTCACTTGTAAATGGGG + Intergenic
1185914589 X:4021956-4021978 AGTTTACTCATTTTTAGTTCTGG - Intergenic
1187444415 X:19348239-19348261 GGTTTGCTCAGTTGTAAAACTGG + Intronic
1188204230 X:27332730-27332752 TGTTTATTCACTTGGAATTATGG - Intergenic
1189652068 X:43201076-43201098 TATTTACTCAGTGGTAATTCAGG + Intergenic
1191178999 X:57539466-57539488 GTTTTACTCATTTGTAATTTTGG - Intergenic
1191206985 X:57844975-57844997 TGTTTACCCAGTAGTAATTCAGG - Intergenic
1194034291 X:88852332-88852354 CCTTTGCTCCCTTGTAATTCAGG + Intergenic
1194761920 X:97804943-97804965 GGTTTCCTCATTTGTAAAACTGG - Intergenic
1194775710 X:97961542-97961564 GGTTTTCTCATTTGTAAATTTGG + Intergenic
1194848036 X:98836439-98836461 GGTTTACTCAAAAGTAATTCTGG + Intergenic
1195896990 X:109755640-109755662 CATTGACTCACTGGTAATTCAGG - Intergenic
1196215343 X:113044649-113044671 CATTGACTCACTGGTAATTCAGG + Intergenic
1196609827 X:117698986-117699008 CGTTGACTCACTGGTCATTCAGG - Intergenic
1197511378 X:127372774-127372796 TGATTATTCACTTGTAATTTGGG - Intergenic
1198295117 X:135279739-135279761 TATTTACTCACTAGTCATTCAGG + Intronic
1201318593 Y:12672595-12672617 GGTTTTCTCACTAGGAATTTGGG - Intergenic
1202386351 Y:24330326-24330348 GGTTTTCTCACTTGTAAATGGGG + Intergenic
1202484435 Y:25339802-25339824 GGTTTTCTCACTTGTAAATGGGG - Intergenic