ID: 924082568

View in Genome Browser
Species Human (GRCh38)
Location 1:240414375-240414397
Sequence TTCACCAGTATTGTGGAGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924082566_924082568 30 Left 924082566 1:240414322-240414344 CCATTTTGCAGGTGAGGAAATGA 0: 2
1: 25
2: 147
3: 953
4: 3784
Right 924082568 1:240414375-240414397 TTCACCAGTATTGTGGAGTGCGG 0: 1
1: 0
2: 0
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924082568 Original CRISPR TTCACCAGTATTGTGGAGTG CGG Intronic
905325937 1:37151992-37152014 TTCCCCAGCATTGTGCAGTGAGG - Intergenic
909049854 1:70754026-70754048 TGGACCAGTCTTGTGGAGGGAGG + Intergenic
911390006 1:97229929-97229951 TTTACCAGAATTGTGAAGAGGGG - Intronic
913144102 1:115972394-115972416 TGCAACAGTATTGGGAAGTGTGG - Intergenic
917586257 1:176430133-176430155 TGCAACAGTATTGGGAAGTGGGG - Intergenic
918485318 1:185022585-185022607 TGCAACAGTATTGGGAAGTGGGG - Intergenic
920693060 1:208161314-208161336 TTCACCAGCCTTCTGGTGTGAGG - Intronic
924082568 1:240414375-240414397 TTCACCAGTATTGTGGAGTGCGG + Intronic
1064210627 10:13357907-13357929 TTCACCAGAAGTGAGGAGGGTGG - Intergenic
1064698717 10:17995280-17995302 TTCTCCTGTATGGTGGATTGTGG - Intronic
1065979681 10:30880020-30880042 TTCACCAGTTTTGAGCAGTTTGG - Intronic
1067272465 10:44804232-44804254 TTCACCAGCAGTGGGGAGAGGGG + Intergenic
1072272193 10:93787412-93787434 TTCACCAGAATTGTGAGATGGGG - Intronic
1074184699 10:111090258-111090280 TCCCCCAGTTTTGTGGAATGTGG + Intergenic
1075289408 10:121215401-121215423 TTCACCAGCATTGTTGAGTTTGG + Intergenic
1076548978 10:131265033-131265055 CTCACCAGGATTGTGAAGTTTGG - Intronic
1077747901 11:4928022-4928044 AAGACCAGTATTGTGGCGTGTGG + Intronic
1079658941 11:23017060-23017082 TTCACAAGTATATTGGAGGGAGG + Intergenic
1083121515 11:60517561-60517583 TTCACAAGTATGCTGGAGTGGGG - Intronic
1084559815 11:69897441-69897463 TGCAGCAGTATTGGGAAGTGGGG - Intergenic
1094873743 12:34616762-34616784 TTCATCAGCATTGTGATGTGTGG + Intergenic
1095263112 12:40121078-40121100 CTCATCAGTATTTTGGAGTTTGG + Intergenic
1099505255 12:83467718-83467740 TTCACCTTTCTTTTGGAGTGGGG + Intergenic
1099731284 12:86506958-86506980 TTGACCAGGATTGTGAAATGTGG + Intronic
1102806626 12:115787060-115787082 TTCACCAGGCTTCTAGAGTGGGG - Intergenic
1106522929 13:30513800-30513822 TGCAACAGTATTGAGAAGTGGGG - Intronic
1106775007 13:33000209-33000231 TTCACCAGAAGACTGGAGTGGGG + Intergenic
1108742997 13:53358023-53358045 TTTACCAGTAATGGGGAGTTTGG + Intergenic
1112530550 13:100198202-100198224 TGCACCAGTATTATGGAGACCGG - Intronic
1112702068 13:102021396-102021418 TTCCCCAGGATTAGGGAGTGAGG - Intronic
1113555429 13:111230243-111230265 TTCACTGGTATTGAGGAGTGGGG - Intronic
1118375910 14:65176829-65176851 TTCTCCAGTATTGTGGGTGGTGG + Intergenic
1119157054 14:72421198-72421220 TTCACCAGAAATGTGGGGTGAGG + Intronic
1121904987 14:97731546-97731568 CTCATCAGTATTATGGAGTAAGG - Intergenic
1124251374 15:28108078-28108100 CTCACCAGCATTGTGAATTGTGG - Intergenic
1125425082 15:39540415-39540437 TTCACCAGGACTGTGGATAGGGG + Intergenic
1125886463 15:43233450-43233472 TTCCCCGGTGTTGTGGAGTCTGG + Intronic
1126590528 15:50335384-50335406 TTCATCAGTCTTATGGGGTGAGG - Intronic
1128665279 15:69533076-69533098 TTCCCTGGTCTTGTGGAGTGAGG + Intergenic
1132691837 16:1185156-1185178 TTCACCTGTGTTGTGGCGTGTGG + Intronic
1135265995 16:21026252-21026274 CCCACCAGTAGTGTGGACTGAGG + Intronic
1137998347 16:53245361-53245383 TTCAACTGTATTTTGGAGAGGGG - Exonic
1140151644 16:72373225-72373247 TTCATTAATAATGTGGAGTGGGG - Intergenic
1146097141 17:29941638-29941660 TTCAATAGAATTGTGGGGTGAGG + Exonic
1150593777 17:66585655-66585677 GGCACCAGCAATGTGGAGTGGGG + Intronic
1151286296 17:73113978-73114000 TGTACCAGTATTGAGAAGTGGGG + Intergenic
1156093493 18:33500119-33500141 ATCCCAAGAATTGTGGAGTGGGG + Intergenic
1156942362 18:42784053-42784075 TTCACTAGTTATTTGGAGTGAGG + Intronic
1157169531 18:45389784-45389806 TTCACAGATATTTTGGAGTGGGG - Intronic
1157800734 18:50618778-50618800 GTGACCATTATTATGGAGTGGGG + Intronic
1159860877 18:73647857-73647879 TCTACAAGTATTCTGGAGTGAGG + Intergenic
1159979972 18:74766396-74766418 TTTCCCAGGATTGTGGAGAGTGG + Intronic
1166249244 19:41555665-41555687 TTCTACAGCATTGTGCAGTGTGG - Intronic
1168184606 19:54691517-54691539 TTCACCCGTGTTGTAGAATGTGG - Intronic
926436318 2:12841658-12841680 TTCAAAAGAATTGTGGTGTGAGG + Intergenic
926860888 2:17307505-17307527 TTAACCAGTTTTGAGGAGTCAGG + Intergenic
927698541 2:25252905-25252927 TTCACCTGTAGTGTGGAGGCGGG - Intronic
927935401 2:27072993-27073015 TTCACCAGTGTTGTGTGGAGGGG - Intergenic
928805682 2:35150255-35150277 ATCTTCAGCATTGTGGAGTGTGG + Intergenic
932101832 2:68908331-68908353 TGTACCAGTATGGTGGCGTGGGG - Intergenic
932359626 2:71093273-71093295 TGCTCCAGTATGGTTGAGTGTGG - Intergenic
933344938 2:81071342-81071364 TTCATCATTATTTTCGAGTGAGG - Intergenic
936412085 2:112268952-112268974 TGCAACAGTATTGGGAAGTGGGG - Intergenic
939200356 2:139025955-139025977 TTCACTAATATAGTGGAGTCAGG + Intergenic
941383614 2:164826152-164826174 TTCACCAGAATGGTGAAGCGAGG + Intronic
941838165 2:170049080-170049102 TTCAACTGCATGGTGGAGTGGGG - Intronic
946181842 2:217953662-217953684 GTCACCAGGATTGTGGAGGTGGG - Intronic
947876712 2:233472550-233472572 TTCCCCAGTTTCCTGGAGTGAGG + Intergenic
1168886514 20:1263158-1263180 TTCACCAGAATGCTGGAGTTTGG + Intronic
1169745591 20:8939300-8939322 ATCACCAGTATTGGGGATTACGG + Intronic
1172840738 20:37901725-37901747 TCCACCTGTGTTCTGGAGTGGGG + Intergenic
1172958105 20:38776640-38776662 AATACCAGTATGGTGGAGTGTGG + Intergenic
1175009411 20:55720002-55720024 TCTACCTGTATTGTGGACTGAGG - Intergenic
1177776383 21:25571633-25571655 CTAAGAAGTATTGTGGAGTGAGG + Intergenic
1179116731 21:38500085-38500107 TCCACTAGAATTCTGGAGTGCGG + Intronic
1182846687 22:33437043-33437065 TGCAGAAATATTGTGGAGTGAGG - Intronic
952416523 3:33095718-33095740 TTAACCAGTATCTGGGAGTGGGG - Intronic
959678501 3:109065491-109065513 TTGACCAGTGTTGGGGTGTGGGG - Intronic
963003869 3:140707834-140707856 TGCAACAGTATTGAGAAGTGGGG + Intergenic
969220281 4:5754584-5754606 TTCACTAGTAATGGGCAGTGGGG + Intronic
971522167 4:27567854-27567876 TTTACCAGGAATGTGGAGTTTGG - Intergenic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
980516472 4:133868806-133868828 TACACCAGAATTGTGGGGTTTGG + Intergenic
983477312 4:168229662-168229684 TTCAGCGCTATTGGGGAGTGGGG + Intronic
983756500 4:171343876-171343898 TTCTGCAGTATTATGGAGTTTGG - Intergenic
984219261 4:176953645-176953667 TTAATCAGTACAGTGGAGTGTGG - Intergenic
986821016 5:11466957-11466979 ATAACAAGTATTGTGCAGTGTGG + Intronic
989074313 5:37547147-37547169 TGCACCAGTATTCTTGTGTGTGG + Intronic
990851774 5:60213118-60213140 CTCACCTGTATTGTGGAGTCTGG + Intronic
991920473 5:71651586-71651608 TCCACCTAGATTGTGGAGTGAGG + Intronic
991998855 5:72416387-72416409 TTCAAGAGTAATGTGGAGTAAGG + Intergenic
993633570 5:90317335-90317357 TGCAACAGTATTGGGAAGTGTGG - Intergenic
994562687 5:101396170-101396192 TTCTCCCTCATTGTGGAGTGGGG - Intergenic
997251840 5:132394670-132394692 TTCACCACTAGAGGGGAGTGGGG - Exonic
1001638255 5:173228021-173228043 CACTCCAGTAGTGTGGAGTGGGG - Intergenic
1004908696 6:20260962-20260984 TCCCCCAGTTTTGTGGGGTGAGG + Intergenic
1018109509 6:160521225-160521247 TTCATAAGTTATGTGGAGTGGGG + Intergenic
1018134439 6:160766347-160766369 TTCATAAGTTATGTGGAGTGGGG - Intergenic
1019312282 7:368710-368732 TTCACCAGGAGGGTGGAGAGAGG + Intergenic
1020638647 7:10728009-10728031 TGCACCATCAATGTGGAGTGAGG + Intergenic
1029167387 7:98602348-98602370 TGCACCAGTGTTGAGAAGTGGGG + Intergenic
1030680337 7:112427273-112427295 TGCAACAGGATTGTGGGGTGAGG - Intronic
1036600049 8:10252420-10252442 TTCACCAGTATTGAGTCCTGGGG + Intronic
1037335425 8:17786997-17787019 TTGACAAGCATTGTGGAGTGAGG + Intronic
1041138371 8:54786498-54786520 TTCAAGACTATTGTGGAGTTGGG + Intergenic
1041704216 8:60828688-60828710 TTCCACAGTGTTCTGGAGTGGGG - Exonic
1042261245 8:66861676-66861698 TTCAGCAGAATTGGGCAGTGGGG + Exonic
1042470381 8:69180415-69180437 TTCACCTGTCTTCTTGAGTGAGG + Intergenic
1042822251 8:72942918-72942940 TTCACCAAAATTTTGGAGTTGGG - Intergenic
1046288506 8:112127739-112127761 TGCAGCAGTATTGAGAAGTGGGG + Intergenic
1048809062 8:138268657-138268679 TTCACCAGCAAGGAGGAGTGAGG - Intronic
1049211062 8:141386622-141386644 TTCACCGGGATTGTGGGGTGAGG + Intergenic
1049993675 9:1014126-1014148 TTCATCTGTATTGTTGCGTGCGG + Intergenic
1051901342 9:22045372-22045394 TTCACCAGTAATTAGCAGTGTGG - Intergenic
1052232910 9:26176540-26176562 TTCACCTGGATCTTGGAGTGAGG - Intergenic
1052904454 9:33821323-33821345 TTCTTCAGTATTGTTAAGTGAGG + Intronic
1056365542 9:85900786-85900808 TTCAACAGTATTGGGAGGTGGGG - Intergenic
1186578972 X:10796717-10796739 TTCACCACAAGTGTGGAGGGTGG + Intronic
1186900597 X:14051273-14051295 TTAGCCAGGATTGGGGAGTGTGG + Intergenic
1189274413 X:39775118-39775140 TGCAACAGTATTGGGGGGTGGGG + Intergenic
1190178115 X:48168075-48168097 TGCACCTGTCTTGTGGACTGGGG - Intergenic
1192059136 X:67805172-67805194 TACACAAGTATTGTGTATTGTGG - Intergenic
1193656550 X:84205350-84205372 TTTTTTAGTATTGTGGAGTGAGG + Intergenic
1193963727 X:87957412-87957434 TACACCAGTATTGTGCTGTTCGG - Intergenic
1194078954 X:89433579-89433601 TTCACTAGAATTGTGGAGAGTGG + Intergenic
1194989548 X:100531648-100531670 TATAACAGTATTCTGGAGTGTGG + Intergenic
1195522263 X:105844825-105844847 TTCTCCTGTTTTGTAGAGTGAGG - Intronic
1196487723 X:116232989-116233011 TTCATCAAGATTGTGGAGAGAGG - Intergenic
1197196167 X:123703412-123703434 TTCACCTGTAATGTGCTGTGTGG - Intronic
1197307677 X:124863271-124863293 TATACCAGTATGGTGAAGTGGGG + Intronic
1198333427 X:135643541-135643563 CTCACCAGTAAGGTGGGGTGGGG - Intergenic
1199779786 X:151047764-151047786 TGCAGCAGTATTGGGAAGTGGGG + Intergenic
1200431577 Y:3088901-3088923 TTCACTAGAATTGTGGAGAGTGG + Intergenic