ID: 924082712

View in Genome Browser
Species Human (GRCh38)
Location 1:240416037-240416059
Sequence TTTCACATACAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 404}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924082712_924082719 23 Left 924082712 1:240416037-240416059 CCTTCCTCTTTCTGTATGTGAAA 0: 1
1: 0
2: 1
3: 44
4: 404
Right 924082719 1:240416083-240416105 CTTTTCTACCACCAGCCTGGGGG No data
924082712_924082715 20 Left 924082712 1:240416037-240416059 CCTTCCTCTTTCTGTATGTGAAA 0: 1
1: 0
2: 1
3: 44
4: 404
Right 924082715 1:240416080-240416102 CTCCTTTTCTACCACCAGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 285
924082712_924082716 21 Left 924082712 1:240416037-240416059 CCTTCCTCTTTCTGTATGTGAAA 0: 1
1: 0
2: 1
3: 44
4: 404
Right 924082716 1:240416081-240416103 TCCTTTTCTACCACCAGCCTGGG 0: 1
1: 0
2: 2
3: 30
4: 339
924082712_924082718 22 Left 924082712 1:240416037-240416059 CCTTCCTCTTTCTGTATGTGAAA 0: 1
1: 0
2: 1
3: 44
4: 404
Right 924082718 1:240416082-240416104 CCTTTTCTACCACCAGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924082712 Original CRISPR TTTCACATACAGAAAGAGGA AGG (reversed) Intronic
900533112 1:3164461-3164483 GGCCACGTACAGAAAGAGGACGG + Intronic
901886654 1:12228308-12228330 CTCCACAGACAGAAGGAGGAAGG - Intergenic
902393260 1:16118643-16118665 TTCCACAGACAGAAATAGGGAGG + Intergenic
902659768 1:17892929-17892951 TTTCACACACACAGAGAGAAAGG + Intergenic
902995534 1:20222096-20222118 CTTCACATACAAAAGAAGGAAGG + Intergenic
903014524 1:20353442-20353464 TTACACAGGGAGAAAGAGGAAGG + Intronic
903268971 1:22176085-22176107 TTCCACATCCAGAACAAGGAGGG - Intergenic
905037246 1:34926248-34926270 TGTCACAGACAGAAAAAGTAAGG - Intronic
906749354 1:48245249-48245271 GTTCCCAAAGAGAAAGAGGAAGG + Intronic
907069567 1:51521514-51521536 TTTCTCATACAGGAAAAGTAAGG + Intergenic
908564997 1:65345294-65345316 TTTCCCATATAGAAATAAGAAGG + Intronic
909461787 1:75924542-75924564 ATACACATATAGAAAGAGAAAGG + Intronic
910057833 1:83052708-83052730 TTTCAAATAGAGAAAGGGGAAGG - Intergenic
911501297 1:98688462-98688484 TTTCACAAAGAGGAAGTGGAAGG - Intronic
911697203 1:100903809-100903831 TCACACATACAGAAAAAGCATGG - Intronic
911805041 1:102195131-102195153 TTTCACATGAGGAAAGAGCAAGG - Intergenic
912265489 1:108152926-108152948 TATGACATATAGAAAGAGGAAGG + Intronic
912901566 1:113656245-113656267 TTTCACATATAGACAGAAAAAGG + Intronic
913552562 1:119930066-119930088 TTACACAAACAGAGAGAGTATGG - Intronic
914666235 1:149835206-149835228 TCTCAAAAAAAGAAAGAGGAAGG - Intergenic
914669532 1:149858592-149858614 TCTCAAAAAAAGAAAGAGGAAGG + Intronic
916425270 1:164674268-164674290 TTACACATGGACAAAGAGGAAGG + Intronic
916444381 1:164858593-164858615 TTTCAATTAAACAAAGAGGAAGG + Intronic
916951641 1:169786095-169786117 TTTCAGAAACACAAAGAGGGAGG + Intronic
918082185 1:181216215-181216237 TTTCTCATTCACAAAGAGGCTGG - Intergenic
918535032 1:185564639-185564661 CTTCTCATAGAGAAAGAGTAGGG - Intergenic
918535921 1:185574281-185574303 TTTCACATACAAAATGAGTAGGG - Intergenic
919537372 1:198804991-198805013 ATTCACATACAGAAAGACATGGG - Intergenic
921294483 1:213689166-213689188 TCTAACATCCAGAAAGAGGGAGG - Intergenic
922163893 1:223098770-223098792 TTTCCCATTCAGAAGGAAGAGGG + Intergenic
923427209 1:233882872-233882894 TTACCCAAACAGAAAGAAGAGGG - Intergenic
924068550 1:240252781-240252803 TTAGACATACAGATACAGGAAGG - Intronic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
924612093 1:245581911-245581933 TGTCAAAGAGAGAAAGAGGAAGG + Intronic
1063514516 10:6681935-6681957 TTTTTCAGGCAGAAAGAGGAAGG + Intergenic
1064846479 10:19660567-19660589 TTTCACATGGAGAAAGGTGAAGG - Intronic
1065847656 10:29759455-29759477 GTCCACATACACAAAGAAGAAGG - Intergenic
1066203465 10:33163939-33163961 TTCCTCATACAAAAGGAGGATGG - Intergenic
1067032201 10:42885588-42885610 TTTCTCCCACTGAAAGAGGATGG + Intergenic
1067928659 10:50537657-50537679 TTTCACAAAAAGAAACAGGATGG - Intronic
1068527468 10:58146882-58146904 TGTCAAATATAGAAAGAGGATGG + Intergenic
1068881259 10:62051360-62051382 GAACACATTCAGAAAGAGGACGG - Intronic
1069384042 10:67868301-67868323 TTTCACATATATAAAGTGGAGGG - Intergenic
1071187486 10:83060973-83060995 TTTAAGACACAGAAAGAGGGTGG - Intergenic
1072015059 10:91338369-91338391 TTCCACACACAGGAAGAGGAGGG - Intergenic
1073348525 10:102802139-102802161 TCACACACACAAAAAGAGGAAGG - Intronic
1073633423 10:105172461-105172483 TTTAACATACAGATAGAATAAGG - Intronic
1074031333 10:109691607-109691629 GTTAAGATATAGAAAGAGGAAGG + Intergenic
1074376564 10:112945800-112945822 TTTCAAATTTAGCAAGAGGAAGG - Intergenic
1074459452 10:113624137-113624159 ATTCACATGCAGAAAGGGAAAGG - Intronic
1074960956 10:118445429-118445451 ATTCACATACAGAAAAACCAGGG - Intergenic
1075449727 10:122542061-122542083 ATTAACAGACATAAAGAGGATGG - Intergenic
1077063626 11:628130-628152 ATCCACAGACAGAAAGTGGACGG - Intergenic
1077755408 11:5023725-5023747 TTTCACATAGAGAAATGGAAGGG + Intergenic
1078831876 11:14985341-14985363 TTCCACATGCAGAAAAATGAAGG - Intronic
1080274187 11:30485565-30485587 TTTTACTTACAGAAGGAGGGAGG - Intronic
1080362277 11:31529680-31529702 TTTCTCATATAGGAAAAGGAGGG + Intronic
1080704833 11:34680664-34680686 TTTCACTTTCAGACAGAGAAAGG + Intergenic
1081351094 11:42053091-42053113 TTACACACAAAGAAGGAGGAAGG - Intergenic
1081503633 11:43691929-43691951 TTTCACAAACAGGAAGAGTGAGG - Intronic
1084539677 11:69777965-69777987 TTTCACATAAAGAAAAAAAAAGG - Intergenic
1084845605 11:71897021-71897043 TTCCACATACAGAAGAATGAAGG + Intronic
1085912801 11:80848460-80848482 TGACAGACACAGAAAGAGGAAGG - Intergenic
1086023433 11:82260509-82260531 TTTCCAATACAGAAGTAGGAAGG - Intergenic
1087171742 11:95056564-95056586 TATGAAATACAGAAAGAGGGCGG + Intergenic
1087326652 11:96732105-96732127 TTTCAAATAATGAAAGAGAATGG - Intergenic
1087557975 11:99746710-99746732 TTCCACAGACAGCAAGAAGAGGG - Intronic
1087588820 11:100157639-100157661 ATTCACATAAAGAAAGAAGGTGG + Intronic
1087651110 11:100869252-100869274 TTTTTCAGACAGAAAGATGAAGG + Intronic
1087716814 11:101617865-101617887 TTCCACACACCGTAAGAGGAGGG + Intronic
1087961025 11:104349407-104349429 TTTCATGTACAGAGAGGGGAGGG + Intergenic
1088122459 11:106386310-106386332 ATTTACAAACAGAAAAAGGAAGG - Intergenic
1088197453 11:107291265-107291287 TTTCATATACAGAGAGAGATAGG + Intergenic
1088891633 11:114049291-114049313 TTTCCCAAAATGAAAGAGGATGG - Intergenic
1090421469 11:126578330-126578352 TATCTCACAAAGAAAGAGGAGGG + Intronic
1090563554 11:127961069-127961091 TATCTCATAAAGAAAGAGGTGGG + Intergenic
1090894160 11:130954625-130954647 ATTCTGATACAGAATGAGGATGG - Intergenic
1091048906 11:132350409-132350431 TTTCACATACAGACAGAATAAGG + Intergenic
1091106407 11:132923503-132923525 TGTCATATATAGAAAGAGGTTGG + Intronic
1091124989 11:133086497-133086519 TTTCATCTACAGGAAGAAGATGG - Intronic
1091717360 12:2788577-2788599 TTTCACAAACATAATGTGGAAGG + Intergenic
1092076058 12:5674507-5674529 TCTCACATACAGAAAGTGGCTGG + Intronic
1093227853 12:16507171-16507193 TTCTACATACAGAAAGCAGAGGG + Intronic
1093790660 12:23245652-23245674 TTTCACATGCTCACAGAGGAAGG + Intergenic
1094107348 12:26828518-26828540 TGTCACAGACAGAAAGCAGAGGG + Intronic
1096778337 12:53977302-53977324 ATACAAAGACAGAAAGAGGAGGG - Exonic
1096944198 12:55386026-55386048 TCTCAAAAACAAAAAGAGGAAGG - Intergenic
1097337768 12:58403602-58403624 TTTAACATAGAGAATGAGGTGGG - Intergenic
1098505360 12:71243148-71243170 TTTCACATGTAAAAAGAGGAGGG - Intronic
1099298625 12:80863141-80863163 TTTGATAGAAAGAAAGAGGAAGG + Intronic
1099518485 12:83629032-83629054 TTTCTCATACATAAAGAACAGGG - Intergenic
1100400085 12:94221778-94221800 TCTCACATACAGAAGGGGCAGGG + Intronic
1100805200 12:98276243-98276265 AGTCCCATACAGAAAAAGGAGGG + Intergenic
1101506155 12:105348462-105348484 TTTCAAAAACAGAGAAAGGAGGG - Intronic
1101696441 12:107131786-107131808 TTTCACATTTAGAAAGAAAAAGG - Intergenic
1102061113 12:109931743-109931765 TTTCACATTCAGAACAAGAAGGG + Exonic
1102353459 12:112212482-112212504 GTTCACATTCAGAAAAAGGCAGG - Exonic
1102899678 12:116626585-116626607 GCCCACTTACAGAAAGAGGATGG + Intergenic
1104717393 12:131025222-131025244 TTTATCATACCGAAAGAGGATGG + Intronic
1104997501 12:132667780-132667802 TTTCTCATACCGAAAAAGGTGGG + Intronic
1105297191 13:19098020-19098042 TCTAACATACAGCAACAGGAGGG - Intergenic
1107631344 13:42345658-42345680 TTTCAGATTCAGAGACAGGAAGG - Intergenic
1108932254 13:55839830-55839852 TTTGACATACAGAAAATGTAGGG - Intergenic
1109446107 13:62442843-62442865 TTGCCCAGACAGAAAGATGAGGG - Intergenic
1110918922 13:81059695-81059717 TTTCACATAAAGAAAAATGTAGG - Intergenic
1110991997 13:82053568-82053590 TTTTATATACAGTAAAAGGAAGG - Intergenic
1111481848 13:88839433-88839455 ATTGACACACTGAAAGAGGAAGG - Intergenic
1111736988 13:92154127-92154149 TATCACATGGAGAGAGAGGATGG + Intronic
1113174245 13:107544192-107544214 TTTCACTCACATAAAGAGGTGGG + Intronic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1113709968 13:112456757-112456779 GTTCTGCTACAGAAAGAGGAAGG + Intergenic
1114961909 14:27902254-27902276 TTACAAATACAGAGAGAAGATGG - Intergenic
1115786669 14:36834429-36834451 TTTCAGATAAAGAAACAGAAAGG - Intronic
1116907659 14:50420704-50420726 TTTCACTAACAGGAAGAGGATGG + Intronic
1117304928 14:54464008-54464030 ATCCACATAAAGAGAGAGGATGG - Intergenic
1117902254 14:60547126-60547148 TTTCATATAGAGTAAGAGGTGGG + Intergenic
1118227080 14:63911766-63911788 TTTCACATCCAGAATATGGAGGG + Intronic
1118664707 14:68055166-68055188 TTTCACATTCATAAAAATGAAGG + Intronic
1119974507 14:79010519-79010541 TTTCACAACCCAAAAGAGGAGGG + Intronic
1120445392 14:84588543-84588565 TTTCAAATACAGCCAGAGGAGGG + Intergenic
1120944246 14:89978826-89978848 TTTCACAAATGGAAAGAAGATGG + Intronic
1121371827 14:93365801-93365823 TTTCAGATAGAGAAAATGGAAGG + Intronic
1122157716 14:99760292-99760314 TTGCACAGAAAGAAAGAGAAGGG - Intronic
1123586105 15:21762008-21762030 TCTCACATACAGAAGGTGGCTGG - Intergenic
1123622746 15:22204598-22204620 TCTCACATACAGAAGGTGGCTGG - Intergenic
1125675885 15:41502390-41502412 TCCCACATCCAGAAAGCGGACGG + Exonic
1125826295 15:42679354-42679376 TGGAGCATACAGAAAGAGGAAGG - Intronic
1127728900 15:61780038-61780060 TCTCACAGACAGGGAGAGGAAGG - Intergenic
1127764152 15:62168352-62168374 TCTCACATACAGTAAAAGCAGGG + Intergenic
1127863851 15:63015635-63015657 TTCCTCATACACTAAGAGGAAGG + Intergenic
1127948897 15:63784986-63785008 TTTCTCAGACAAAGAGAGGAAGG + Intronic
1128727074 15:69996119-69996141 ATTCACCTACAGAAAGAGCAGGG - Intergenic
1129271802 15:74422877-74422899 TTTCACAAACAACAAGAGTATGG - Intronic
1130090812 15:80819707-80819729 CTTCTCTTAGAGAAAGAGGAAGG + Intronic
1130267892 15:82425083-82425105 TTTCAAATATAGAAACAGGCAGG - Intergenic
1130504132 15:84521751-84521773 TTTCAAATATAGAAACAGGCAGG + Intergenic
1131238316 15:90716671-90716693 TATCACACACACAAAGAGGAGGG + Intergenic
1134151186 16:11806258-11806280 TTTCACATACTGAATGACAAAGG - Intergenic
1134409097 16:13988589-13988611 TTTCACAAATACTAAGAGGAAGG + Intergenic
1135077630 16:19407731-19407753 GTTTCCACACAGAAAGAGGAGGG + Intergenic
1135164438 16:20126281-20126303 TTCCCCAAACAGGAAGAGGAGGG - Intergenic
1135948590 16:26889844-26889866 TTCCAGACTCAGAAAGAGGAGGG - Intergenic
1137481465 16:48855249-48855271 AGTCACAGACAGAAAGAGGCAGG + Intergenic
1138838095 16:60462750-60462772 TTTCATATAGAGTAAGAGGTAGG + Intergenic
1138880221 16:61004488-61004510 TTTCACAAAGAGAAAATGGAGGG + Intergenic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1140744055 16:77965512-77965534 TTTCCCATCCAGACAGTGGAGGG - Intronic
1140862661 16:79032040-79032062 TATTACATACAGAAGGAGGCAGG - Intronic
1140901176 16:79369488-79369510 TTTCACATATACTAAGAGAAAGG + Intergenic
1142352064 16:89585098-89585120 TTTCACCTGCAGGAAGTGGAAGG - Intronic
1142950542 17:3475536-3475558 TTTCACAATCAGAAACAGAAGGG - Intronic
1144057307 17:11554614-11554636 TGTCCCAAACAAAAAGAGGATGG + Intronic
1146136350 17:30324214-30324236 TTGCTCATACAAAAAGAGAAAGG - Intronic
1147002469 17:37373780-37373802 TTTCAAATAGAGCAACAGGAGGG + Intronic
1147450067 17:40498923-40498945 CTTCACATCCAGAAAGATGGTGG + Intronic
1147538915 17:41340243-41340265 TTACTAAAACAGAAAGAGGAAGG - Intergenic
1149431552 17:56598198-56598220 TTTCAAATACTGGAAGAGAATGG + Intergenic
1150039616 17:61845743-61845765 TTTTGCATACAGAAGCAGGATGG - Intronic
1150204531 17:63392357-63392379 TTGAAAATCCAGAAAGAGGAGGG - Intronic
1150664840 17:67123880-67123902 TTTCACCACAAGAAAGAGGAGGG - Intronic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1150842413 17:68621152-68621174 TTTCACAAACAGCATGAGGTTGG - Intergenic
1152119951 17:78412385-78412407 TTTCCCATATAGAAAGAATAAGG - Intronic
1153002551 18:469148-469170 TTGCACAGACGGAAAGAGGTGGG + Intronic
1153079019 18:1198404-1198426 GTTCAAATAAAAAAAGAGGATGG - Intergenic
1153112263 18:1605962-1605984 TTTCACAGAAAAAATGAGGAAGG - Intergenic
1153935735 18:9919660-9919682 TTTACCATACTGAAAGAGGTCGG + Intronic
1154203503 18:12317586-12317608 TTAGAAATACAGAAAGAGGCTGG - Intronic
1156057810 18:33031672-33031694 ATTAACACAAAGAAAGAGGATGG - Intronic
1156426936 18:37023998-37024020 TGTCACATACACAAAAAAGAAGG - Intronic
1156627875 18:38931575-38931597 CTGCACCTCCAGAAAGAGGAGGG + Intergenic
1157694536 18:49710398-49710420 TTCCAAATGCAGAGAGAGGAGGG - Intergenic
1158641514 18:59207705-59207727 TCTTCCATACAGGAAGAGGAAGG - Intergenic
1159877436 18:73828062-73828084 TTTCATATTCACGAAGAGGAAGG + Intergenic
1160149524 18:76388494-76388516 TTTCAGATCCACAAGGAGGAAGG + Intronic
1161041680 19:2113766-2113788 TTTCACATAGAGAAAGAAATGGG - Intronic
1161884044 19:6979675-6979697 TCCCAGATACAGGAAGAGGAGGG + Intergenic
1164515185 19:28928258-28928280 ATTCTCATCCAGAAAGTGGAGGG + Intergenic
1164889119 19:31807900-31807922 TTTCCCATGCAGGAACAGGATGG - Intergenic
924959421 2:20299-20321 TTTCACAGTCAGCACGAGGATGG - Intergenic
925386886 2:3468186-3468208 TTGCACAAGCAGAAAGAGAAGGG - Intronic
925478583 2:4245884-4245906 TTTCACTAACATAAAGATGAAGG + Intergenic
927585011 2:24294898-24294920 CTTCACATGCAGAAAGGGTAAGG - Intronic
928190881 2:29166320-29166342 TTTTACAAACAGAAAGGGGTGGG - Intronic
928484349 2:31714404-31714426 TTTCACAAAAAGGAAGAGGAAGG + Intergenic
928667672 2:33566949-33566971 TATCACGAACAGAAAAAGGAGGG + Intergenic
929180858 2:39037220-39037242 TTTCAAAAACAACAAGAGGATGG + Intronic
929205817 2:39291587-39291609 TTTTAGAAACAGAAAGAGGCTGG + Intronic
929208863 2:39330456-39330478 TTTCACACACACAAAAAGGAAGG + Intronic
929646088 2:43629798-43629820 TTTCACATATGAAAAGAGGTTGG + Intergenic
930141397 2:47954438-47954460 TTTCAGGTCCAGAAGGAGGAGGG - Intergenic
930155539 2:48103837-48103859 TTTCACACACAGCAAAAGTATGG + Intergenic
931240827 2:60450858-60450880 TTACACATACAGACCCAGGATGG - Intergenic
931300950 2:60977829-60977851 TTTCTCAAACCGTAAGAGGAAGG + Intronic
931485032 2:62682108-62682130 TTTGACATTCAGAAGGAGGCTGG + Intronic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
933306590 2:80607846-80607868 TTTCACATAGTGAAAGTTGAAGG + Intronic
933325310 2:80828527-80828549 TATCACATATATAAAGATGATGG + Intergenic
933787349 2:85854085-85854107 TTTTTCATAGAGAAAGAGGAAGG - Intronic
934111615 2:88748653-88748675 TTTCACACACATACAGATGATGG - Intronic
934570476 2:95368600-95368622 GTTCACACACAGAAACGGGATGG - Intronic
935082189 2:99809049-99809071 ATTCACATACCTAGAGAGGAAGG + Intronic
935508882 2:103946171-103946193 TTTCATATACTGAAAGAGTGTGG - Intergenic
936434714 2:112494309-112494331 TATAACAGAAAGAAAGAGGATGG + Exonic
936956709 2:118029768-118029790 ATTCCCATACATAAAAAGGAAGG + Intergenic
937180472 2:119991412-119991434 ATTCAAGTACAGAAAGAGGCGGG + Intergenic
937438832 2:121900257-121900279 TCTCACAGACAGCAAGAGGCAGG + Intergenic
937722156 2:125113108-125113130 TTTTACATATATAAAGAGTATGG - Intergenic
937727163 2:125180878-125180900 ATGCACACACAGAGAGAGGAAGG - Intergenic
937799811 2:126070444-126070466 CTTCACATTGAGAAGGAGGAAGG - Intergenic
937818503 2:126280630-126280652 ATTCACATACAAAGAGAGAAGGG + Intergenic
938162958 2:129002917-129002939 TCTCACAAGCGGAAAGAGGATGG - Intergenic
939894277 2:147772947-147772969 TTTCACACACAGCAATATGAAGG + Intergenic
940870625 2:158857185-158857207 TTCCACATGCAGAAGAAGGAAGG + Intronic
941202774 2:162533476-162533498 TTTAAAATACAGAAAGAAAATGG + Intronic
941435747 2:165469247-165469269 TTTGATATGCAGACAGAGGAGGG - Intergenic
942118575 2:172753814-172753836 CCTCACAAACCGAAAGAGGAAGG - Intronic
942596740 2:177598813-177598835 TTTCACAGATGGAAAAAGGAAGG + Intergenic
943015832 2:182509550-182509572 TTTCACATTTAGTAAGGGGAGGG - Intronic
943174998 2:184460881-184460903 TTTCAGAGAGAGAAAGAGGAAGG + Intergenic
943342985 2:186703541-186703563 TGACACAAACAGAAACAGGATGG + Intronic
943901015 2:193436786-193436808 TTTCAAATACTGAAAAATGAAGG - Intergenic
944051226 2:195472283-195472305 TTTCAAATAAAGAAAGGGGAAGG - Intergenic
944739834 2:202601099-202601121 TTTCACACACAGAAAGAGCGAGG - Intergenic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
945635795 2:212348937-212348959 ATTCACATAAAGAAAGAGAGCGG + Intronic
945656472 2:212630384-212630406 TTTTAGAGAAAGAAAGAGGAGGG - Intergenic
945814366 2:214585902-214585924 TTTCACTTGCAGAAAATGGAAGG + Intergenic
945845210 2:214936251-214936273 TTTCTTATACAGAAACAGGCAGG - Intronic
946594551 2:221291934-221291956 CTTCCCATACATAATGAGGATGG - Intergenic
948238133 2:236405778-236405800 TTTCCTATACAGAAACAGGCAGG + Intronic
948636768 2:239343400-239343422 GTTCACAAAAAGACAGAGGAAGG + Intronic
1168913001 20:1465100-1465122 TTACACATACAGAAGGAATATGG + Intronic
1169245752 20:4023227-4023249 TTCCACCTCCAGAAAGAGCATGG + Intergenic
1169941288 20:10940535-10940557 TTTGTCCTACAGAAGGAGGATGG + Intergenic
1170111746 20:12811787-12811809 TTTCAAAAACTAAAAGAGGAGGG + Intergenic
1173055030 20:39603714-39603736 ATTCAGAGACAGAAAGTGGAAGG - Intergenic
1173416834 20:42864320-42864342 TCACACACACAGAGAGAGGAGGG + Intronic
1177751499 21:25290524-25290546 TTTAACAAACAGTAAGAGAATGG + Intergenic
1177944128 21:27446131-27446153 TTTCCCATACAGGAAGAGGAGGG + Intergenic
1178630004 21:34251434-34251456 TCTCAAATACAGAAAGAGGGAGG + Intergenic
1178779332 21:35586637-35586659 TTTCAAAGACAGAAAGACTAAGG - Intronic
1179166372 21:38938321-38938343 TCACAGAGACAGAAAGAGGAGGG - Intergenic
1179177328 21:39018309-39018331 ATTCACATCCAGAAAGCTGAGGG - Intergenic
1179523708 21:41961890-41961912 CTTCACAGACTGAAAGAGAAGGG - Intergenic
1181004308 22:20003315-20003337 TTTCCCAAAAATAAAGAGGAAGG + Intronic
1183584674 22:38746034-38746056 TGCCACTTACAGAAAGATGAAGG - Intronic
1184641971 22:45877645-45877667 TTTCTCGTCCAGGAAGAGGATGG + Intergenic
1185019226 22:48364097-48364119 TTTCACCTCCAGGAAGGGGATGG + Intergenic
1185163914 22:49246073-49246095 GTTCAGAGACAGAGAGAGGATGG + Intergenic
951385851 3:22041500-22041522 TTTAAAATACAGAATGTGGAAGG + Intronic
951445508 3:22775122-22775144 ATTCACATCCAGAAAAATGATGG - Intergenic
952470647 3:33647657-33647679 TTTTATATACAAAAACAGGAGGG + Intronic
952644062 3:35635238-35635260 TTTCACACAAAGAAAGACAAAGG - Intergenic
952810342 3:37396895-37396917 ATTCAACTACAGAAACAGGAGGG - Intronic
953301475 3:41780913-41780935 ATTCCCACACAGAAAGGGGAAGG + Intronic
953342653 3:42148672-42148694 TGTCACATACAAATAGAGGAGGG - Intronic
954579561 3:51695918-51695940 TTCCACATGCAGAAACAAGATGG - Intronic
956230788 3:67014155-67014177 TGGCACAGCCAGAAAGAGGATGG - Intergenic
957628940 3:82693528-82693550 TTTCAAACACAGAAAAATGATGG + Intergenic
957646711 3:82939649-82939671 TTTCACATCCAGAAAGAATGCGG - Intergenic
957725413 3:84058981-84059003 TTTAACATACTGAAAGAAGAGGG - Intergenic
958123636 3:89326828-89326850 TTAAAAAAACAGAAAGAGGATGG - Intronic
959346516 3:105201674-105201696 TTTCACATTCAGAAACTGAAAGG - Intergenic
959930634 3:111978527-111978549 TTTCGCATATAGCACGAGGAGGG + Intergenic
960644206 3:119860508-119860530 TTCCATATTCAGATAGAGGAAGG - Intronic
960750320 3:120943936-120943958 TTTAACATATTGAAAGATGAGGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963080732 3:141391440-141391462 CTTCCCCTACAGTAAGAGGATGG + Intronic
963351452 3:144156973-144156995 TTTCACATAAAGAAATATCAAGG - Intergenic
963405307 3:144855751-144855773 TTTCACAATCAGAAATTGGAGGG - Intergenic
964733385 3:159891367-159891389 TTTCAAAAAAAGAAAAAGGAAGG + Intronic
965583743 3:170296712-170296734 TTTCACATAGTGAAAAATGAAGG + Intronic
965770462 3:172176535-172176557 TTTCATGTACAGGAAGAGGAAGG + Intronic
966268109 3:178071128-178071150 TTTCACAGGCAGAAAGGAGAAGG - Intergenic
966509882 3:180749856-180749878 TTTCACACACATTAAAAGGAGGG + Intronic
967088193 3:186112819-186112841 TTTCTAACAGAGAAAGAGGAGGG - Intronic
967527911 3:190515030-190515052 TTTCACAACCAGAAGGTGGAGGG - Intronic
968176812 3:196557642-196557664 TTTCAGATGCAGAAAGGGGCAGG + Intronic
969102530 4:4780034-4780056 TTTCTAAGACAGAAAGAGGTGGG - Intergenic
969246436 4:5936263-5936285 TTAGAAAGACAGAAAGAGGATGG + Intronic
970113257 4:12662771-12662793 CATCAAATAGAGAAAGAGGAAGG + Intergenic
970743537 4:19266745-19266767 TTCCACATGCAGTGAGAGGAGGG + Intergenic
971752556 4:30669067-30669089 TTATAAATACAGAAAGAAGATGG + Intergenic
976231021 4:82843032-82843054 TTTTACATACAGTATGAAGATGG + Intronic
976620134 4:87119030-87119052 TTTTCCACACAGAAAAAGGAGGG + Intronic
978014098 4:103722592-103722614 TTTCACATTAAGAAATAGGAAGG + Intergenic
978247288 4:106589247-106589269 ATGAACAGACAGAAAGAGGATGG - Intergenic
979305666 4:119140068-119140090 TTTCACACAGAAAATGAGGAAGG + Intronic
980626121 4:135376860-135376882 ATTCAAATAGAGAGAGAGGAAGG - Intergenic
982174877 4:152696248-152696270 TTTAACAGACAAAAAGAGGATGG + Intronic
982756608 4:159226835-159226857 TTTCACTTACAGAACAAGTATGG + Intronic
982842677 4:160211586-160211608 TTTCACAGACATCAAGAGGAGGG + Intergenic
983388407 4:167096833-167096855 TATCAATTACTGAAAGAGGAAGG + Intronic
983731459 4:170999091-170999113 TTTCTCATACTCAAAGTGGAAGG - Intergenic
984057724 4:174949731-174949753 GTTCAGAAACAGAAATAGGACGG - Intronic
985088948 4:186343840-186343862 TTTCACAAACATAAACAGAAGGG - Intergenic
986293157 5:6416486-6416508 TTTCACCTAGAGAAGGTGGAGGG - Intergenic
986800689 5:11257044-11257066 TTTCTGATACAGCAAGAGAAAGG + Intronic
988236198 5:28548500-28548522 TCTGACAGACAGAAAGAAGATGG + Intergenic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
990058081 5:51610867-51610889 TTTCAAATACATAAACAGCAAGG - Intergenic
991119961 5:63001209-63001231 TTTCACAGAGAGAAAGAGAGAGG - Intergenic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
993100529 5:83533407-83533429 TTTCAGAGAGAGAGAGAGGAAGG + Intronic
993148603 5:84130088-84130110 ATACTCAAACAGAAAGAGGAGGG - Intronic
993326300 5:86542208-86542230 TTTTACATAAAGAAATTGGAGGG - Intergenic
993375042 5:87141022-87141044 TTGCACTAACAAAAAGAGGAAGG + Intergenic
993525696 5:88963228-88963250 TTTCACATGCAAAAAGAGTATGG + Intergenic
993755428 5:91723488-91723510 TTACACATACAGAAAGAAAATGG - Intergenic
994535322 5:101023333-101023355 TTTCAAATATACAAAGAAGAAGG + Intergenic
994927205 5:106132205-106132227 CTTAACATAAAGAAAGAAGAAGG + Intergenic
994934029 5:106228854-106228876 TTTAACATACAGAATGACTATGG - Intergenic
995130990 5:108630310-108630332 TTTCACAGACACAGAGAAGAGGG + Intergenic
996471645 5:123867882-123867904 TTTCAAAATTAGAAAGAGGAAGG + Intergenic
997464484 5:134078250-134078272 CTGCACACACAGACAGAGGAGGG + Intergenic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
999533717 5:152492480-152492502 TTACAAATATAGAAAGAGAAAGG - Intergenic
1000254598 5:159525769-159525791 TATCACCTAGAGAAGGAGGAGGG - Intergenic
1000384987 5:160666799-160666821 TTCCACATAGAGATAGAGGGTGG - Intronic
1000741149 5:164972105-164972127 TTACACAGACAGACAGAAGAAGG + Intergenic
1001114554 5:168928580-168928602 TTGCACATACACAAAGAGGCAGG - Intronic
1001673407 5:173492754-173492776 GTTCACATGCACACAGAGGAAGG - Intergenic
1002022959 5:176376563-176376585 TTTCCCATAAAGAAAGGGAAAGG + Exonic
1002993431 6:2259158-2259180 TTTCACAAACGGAAAGAGCATGG - Intergenic
1003437559 6:6106045-6106067 TTTCACAGAGAGAAATAGAAGGG - Intergenic
1003908935 6:10726199-10726221 TTTTACATACAGAACATGGAAGG + Intronic
1005003474 6:21265526-21265548 TGTCACATTCAAAAAGAGCAAGG - Intergenic
1005264743 6:24100356-24100378 TTTCTCAGAAAGAAAGAGGGAGG + Intergenic
1005489490 6:26334043-26334065 TTTGACCAACAGAAAGAGAAAGG - Intergenic
1006254948 6:32823963-32823985 ACACACACACAGAAAGAGGAAGG - Intronic
1007256592 6:40534025-40534047 TTTCTCATGTAGAAAGTGGAAGG - Intronic
1010281615 6:74029657-74029679 TTTCACGAACTGAGAGAGGAAGG - Intergenic
1011266802 6:85529527-85529549 TTTCAGAGAAAGAACGAGGATGG + Intronic
1011468318 6:87681801-87681823 TTTCACATTAAAAAAGAGGTTGG + Intronic
1012146057 6:95683226-95683248 ATGCACTTACAGAAAGAGCAAGG + Intergenic
1012745817 6:103087327-103087349 TCCCACAGACAGAAAGAGTAGGG + Intergenic
1012784536 6:103606629-103606651 TTTCATATATAAAATGAGGATGG + Intergenic
1012948638 6:105494364-105494386 TTACAGAGACAGAAAGAGGGAGG + Intergenic
1013247881 6:108304758-108304780 CTTCACAAAGAGAAAGAAGAGGG - Intronic
1013437979 6:110132385-110132407 TTTCATATACATAAGGATGATGG + Intronic
1013684298 6:112561266-112561288 TATCACAAACAAAAAGAAGAGGG - Intergenic
1014550167 6:122781123-122781145 GTTCACATACAGAAATGGGATGG + Exonic
1014626879 6:123737297-123737319 TTTAACTTACAGACTGAGGAGGG + Intergenic
1014688108 6:124529335-124529357 ATGCACAAACAGAAAGAGAAGGG - Intronic
1015375050 6:132500901-132500923 TTTCACCTTGAGAAGGAGGAAGG - Intronic
1015406215 6:132839622-132839644 TTACAAATACATAAAGATGATGG - Intergenic
1016962626 6:149688178-149688200 TGTGTCATAAAGAAAGAGGAAGG - Intronic
1017360767 6:153566867-153566889 CTTCACAAAAACAAAGAGGAGGG + Intergenic
1017698492 6:157043270-157043292 TTTGAAATGCAGCAAGAGGAAGG - Intronic
1018519658 6:164633277-164633299 TTTCAAAAAAAGAAAGAGAATGG - Intergenic
1018563719 6:165129356-165129378 TTTCACACACAGAAGCAGAATGG + Intergenic
1018723191 6:166589310-166589332 TTTCACATAAAGAAAGAAAAAGG + Intronic
1020042127 7:5012232-5012254 TTTCACAAAAAGAAAGAAGGGGG + Intronic
1020967644 7:14891990-14892012 TTTGCCAGACAGAAAAAGGAAGG + Intronic
1021468281 7:20970363-20970385 TTTGACATACAGAAAGTGCTGGG - Intergenic
1021538752 7:21733440-21733462 TTCCAAATACATAAAGTGGAGGG - Intronic
1022810100 7:33860177-33860199 TTGCACATGGAGAAAGAGGTTGG + Intergenic
1023314029 7:38916862-38916884 TTATACATAAAGAAAGAGTATGG + Intronic
1023376770 7:39564078-39564100 TTTAACATATAGAAAGGAGAGGG - Intergenic
1024871314 7:53964491-53964513 TTTCACAGGCAGGAAGAAGATGG - Intergenic
1026562850 7:71464630-71464652 TTTGACAAACAGAAAGGGCACGG + Intronic
1026918466 7:74137737-74137759 TTGCAGATACAGAAAGAATAGGG + Intergenic
1027052931 7:75031128-75031150 TTTGGCATAGAGAAAGAGGAGGG - Intronic
1027502731 7:78974079-78974101 TTTCAAATTTAGAAAGAGGTAGG - Intronic
1027660396 7:80981553-80981575 TTTTCCACACAGGAAGAGGAGGG + Intergenic
1028295692 7:89128606-89128628 TTTCACACACAGCAAAAGAATGG - Intronic
1028676377 7:93467661-93467683 ATTCACATATAGAATGAGGGGGG - Intronic
1029177390 7:98674706-98674728 TTAAGCATACAGAAAGCGGATGG + Intergenic
1029361601 7:100092211-100092233 TTTCACATACGCAAAAAAGAAGG + Intergenic
1029731436 7:102440846-102440868 TTTCACATAAGGAAACAGGCTGG - Intronic
1031852037 7:126877165-126877187 TTGCAGAGAGAGAAAGAGGAAGG - Intronic
1032273270 7:130431252-130431274 TTTCAATTACATAAACAGGATGG + Intronic
1032461979 7:132118656-132118678 TTCCAGATACAAAAGGAGGATGG + Intergenic
1032730509 7:134637674-134637696 TGTCATTTACAGAAAGAGGTGGG - Intergenic
1034804921 7:154080946-154080968 TTTTACATACAGAGAGCAGAAGG - Intronic
1035118311 7:156543768-156543790 TTTCACTCACAGAATCAGGAAGG + Intergenic
1035776657 8:2192697-2192719 TATCACACACAGAAAGTTGAAGG + Intergenic
1036504294 8:9341389-9341411 TTTAAAAGACAGAAAGAAGATGG + Intergenic
1038241325 8:25810287-25810309 TTTCTCATACAGAAATATCATGG + Intergenic
1039159584 8:34602541-34602563 TTTCAAATACATACAGTGGATGG - Intergenic
1041239553 8:55837903-55837925 TTTCACATAATGAAAATGGAAGG - Intergenic
1041583225 8:59486496-59486518 TTTCCCCCACAGAGAGAGGAGGG - Intergenic
1042076004 8:64995518-64995540 TTTCACACACACAAAAAGCAGGG - Intergenic
1043052178 8:75397754-75397776 GGTCATATAGAGAAAGAGGAAGG + Intergenic
1043153603 8:76749185-76749207 TATCACATACAGATGGTGGAAGG - Intronic
1043728145 8:83639075-83639097 TTTCACATATAAAGAGAAGATGG - Intergenic
1043773115 8:84229681-84229703 TTTGAGATTAAGAAAGAGGATGG + Intronic
1044049122 8:87477984-87478006 TTTCACAAACAGAAAAATAAGGG - Intronic
1044093446 8:88031128-88031150 ACTCACAGAAAGAAAGAGGAAGG - Intergenic
1044180611 8:89189240-89189262 GGTCACATTCATAAAGAGGAGGG + Intergenic
1044360966 8:91283233-91283255 TTAAAAATACAGAAAGAGAAGGG + Intronic
1045239457 8:100386437-100386459 CATCAGATACAGAAAGTGGAAGG - Intronic
1045303627 8:100937170-100937192 TTTCAGATTTAGAAAGAGGTTGG - Intronic
1046616266 8:116480808-116480830 TTCCACATTCAGCAAGAGAATGG - Intergenic
1047299603 8:123601798-123601820 TTTCACATAGAGAAAGCTGAGGG + Intergenic
1047700861 8:127448131-127448153 TTTCACAGGGAGGAAGAGGAAGG + Intergenic
1047879025 8:129171862-129171884 TTTTACAGACAAAAAAAGGAAGG - Intergenic
1048022539 8:130553389-130553411 TTTCAAAAAATGAAAGAGGAGGG - Intergenic
1048059427 8:130902609-130902631 TTTCAAATGCAGAAAAAAGAGGG + Intronic
1048476739 8:134749651-134749673 TTTTACATACAGTATGAGGAAGG + Intergenic
1048525268 8:135196665-135196687 TTGCACAGATAGAAAAAGGAGGG - Intergenic
1048905486 8:139084104-139084126 TTTCAGACAGATAAAGAGGAAGG - Intergenic
1049381539 8:142318899-142318921 ATTCCCACAGAGAAAGAGGAGGG + Intronic
1049458568 8:142709175-142709197 TTCAACATAGAGAAATAGGAAGG + Intergenic
1049869896 8:144966330-144966352 TTTCTCATACAAAAAGCAGAGGG - Intergenic
1050237989 9:3603142-3603164 TGTCATATGCAGGAAGAGGAAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1051051435 9:12936977-12936999 TATAATACACAGAAAGAGGATGG - Intergenic
1052376189 9:27720227-27720249 TTTCAAATACCTAAAAAGGAGGG - Intergenic
1053184387 9:36003080-36003102 CTTCCCATACATGAAGAGGATGG + Intergenic
1054452352 9:65409969-65409991 TTTCTCTTACAGAAAGTGGTCGG - Intergenic
1055451163 9:76432656-76432678 TTTCACATACTGATAGCGGTAGG + Intronic
1056878975 9:90370189-90370211 TTTCTCATACAGGAAGAAGCAGG + Intergenic
1056898286 9:90572255-90572277 ATGTACATACATAAAGAGGAAGG + Intergenic
1057825627 9:98370303-98370325 TTTCACCTGCATCAAGAGGACGG + Intronic
1058109195 9:101012866-101012888 TTCTACATAGAGAAAGATGAAGG + Intergenic
1058339882 9:103881554-103881576 TGTGAAATACAGAAAGAGAAGGG - Intergenic
1058361575 9:104153200-104153222 TTTCACATTATGAAAGAGAAAGG - Intergenic
1058393832 9:104526427-104526449 TTTTGCATACATAAAGAAGATGG + Exonic
1058394547 9:104535941-104535963 TTTCGCATACATAAAGAAGATGG + Exonic
1058400833 9:104617422-104617444 CTTCATATACATGAAGAGGATGG + Exonic
1059072036 9:111147907-111147929 TTGCATAAACAAAAAGAGGATGG + Intergenic
1059599890 9:115765578-115765600 TTACAGAAAAAGAAAGAGGATGG - Intergenic
1061367383 9:130178934-130178956 TTTCAAAAAAAAAAAGAGGAGGG - Intronic
1061387157 9:130297104-130297126 TTTGACAAAAAGAAAGAAGAAGG - Intronic
1186259888 X:7766160-7766182 TTTTACAAAATGAAAGAGGAAGG - Intergenic
1186868523 X:13746172-13746194 TTTGAAATACAAAAAAAGGAAGG - Intronic
1187176172 X:16898074-16898096 TTTCACATACAGCAAAGAGAGGG + Intergenic
1188334202 X:28908765-28908787 TATCAGTTACTGAAAGAGGAGGG + Intronic
1188405047 X:29797480-29797502 TTTAACAAACAGAAGGATGAGGG - Intronic
1189592327 X:42527597-42527619 ATTTATATACAGAAAGAGAATGG - Intergenic
1189954746 X:46265926-46265948 TTTCACATTTAGAATGAAGAGGG - Intergenic
1190888577 X:54550429-54550451 GAGCACATACAGAAAGAGAACGG + Intronic
1192709734 X:73567360-73567382 TTGCGAATACAGAAATAGGAAGG - Intronic
1194063363 X:89232471-89232493 ATTCACATAAAGAAAGGGGCAGG - Intergenic
1194222544 X:91213607-91213629 CTTCATATAGAGACAGAGGAAGG + Intergenic
1194680229 X:96843198-96843220 TGTCACATGGAGAAAGAGTAAGG - Intronic
1195233890 X:102878088-102878110 CTTCACATTGAGGAAGAGGATGG - Intergenic
1195287358 X:103398035-103398057 CTTCACATCAAGGAAGAGGACGG - Intergenic
1195651165 X:107286648-107286670 TTCCACATGCAGAAACAGGAAGG + Intergenic
1195743421 X:108090126-108090148 TTTTACATACTGAAAGAGAAGGG - Intronic
1197442340 X:126507871-126507893 TTTCACACACAAAAAGAAAATGG - Intergenic
1198107957 X:133478945-133478967 TCCCACTTACAGAAAGAGCAAGG + Intergenic
1198764031 X:140062829-140062851 ATTCACATAAACACAGAGGATGG - Intergenic
1199441570 X:147874523-147874545 TTTCATTTACAGAGAAAGGATGG + Intergenic
1199672513 X:150158995-150159017 TTTCATGTGCAGAAAGAGGGAGG - Intergenic
1200717537 Y:6566583-6566605 ATTCACATAAAGAAAGGGGCAGG - Intergenic
1202365775 Y:24162844-24162866 TTTCAAATATAGAAACAGGCAGG - Intergenic
1202505007 Y:25507278-25507300 TTTCAAATATAGAAACAGGCAGG + Intergenic