ID: 924083118

View in Genome Browser
Species Human (GRCh38)
Location 1:240420184-240420206
Sequence CATTCTTTATGGCCTCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924083112_924083118 -9 Left 924083112 1:240420170-240420192 CCCTCTTCCTGATGCATTCTTTA 0: 1
1: 0
2: 1
3: 32
4: 379
Right 924083118 1:240420184-240420206 CATTCTTTATGGCCTCTGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 123
924083113_924083118 -10 Left 924083113 1:240420171-240420193 CCTCTTCCTGATGCATTCTTTAT 0: 1
1: 0
2: 2
3: 31
4: 347
Right 924083118 1:240420184-240420206 CATTCTTTATGGCCTCTGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 123
924083111_924083118 -8 Left 924083111 1:240420169-240420191 CCCCTCTTCCTGATGCATTCTTT 0: 1
1: 0
2: 3
3: 42
4: 444
Right 924083118 1:240420184-240420206 CATTCTTTATGGCCTCTGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 123
924083110_924083118 20 Left 924083110 1:240420141-240420163 CCAACTGCACTGTTCAGTGATGC 0: 1
1: 0
2: 0
3: 17
4: 138
Right 924083118 1:240420184-240420206 CATTCTTTATGGCCTCTGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924083118 Original CRISPR CATTCTTTATGGCCTCTGGG TGG Intronic
902657236 1:17877641-17877663 CAGTCTGGAGGGCCTCTGGGAGG - Intergenic
904056327 1:27672845-27672867 CATTCTTTAAAGCCTTTGGATGG + Intergenic
904425213 1:30418427-30418449 CATTCTTTAGTGCCTGGGGGAGG - Intergenic
907333311 1:53685209-53685231 CCTTCTCTGTGGCCTCTGGATGG - Intronic
909995190 1:82270263-82270285 CATGCTTTCTGGCTTCTGGATGG + Intergenic
912556144 1:110517545-110517567 CATTCCTGATGGCTTCTGGTGGG - Exonic
914851772 1:151319954-151319976 GATTCTTTAGTCCCTCTGGGAGG + Intronic
915508677 1:156373569-156373591 AATTCTTTTTGGGCTCTGAGAGG - Intronic
916479970 1:165206161-165206183 GATTCCTGATGGCCTCTGGTAGG - Intronic
917728552 1:177851106-177851128 CATTCCTTAGGTGCTCTGGGCGG + Intergenic
917845440 1:179016243-179016265 CATTCTTTATGGTCTCTCCTTGG + Intergenic
924083118 1:240420184-240420206 CATTCTTTATGGCCTCTGGGTGG + Intronic
1063562021 10:7137434-7137456 AATTCTTTATGGCGTCTTGATGG + Intergenic
1066612812 10:37267380-37267402 CAATCTCTCTGGCTTCTGGGTGG - Intronic
1070285058 10:75076916-75076938 CATTCTCTGTGGCCTGTGGATGG - Intergenic
1074920265 10:118001394-118001416 CGTTATTTACGGCCTCTGTGAGG + Intergenic
1078488850 11:11750715-11750737 CATCCTTTATGGCCTCAGCCTGG + Intergenic
1078519439 11:12051418-12051440 CATCCCTTATGGCCTCTCTGAGG + Intergenic
1079023013 11:16924589-16924611 CACCCTTTCTGCCCTCTGGGAGG + Intronic
1081053817 11:38382844-38382866 CATTCTTTATGCCCTGATGGAGG - Intergenic
1087612298 11:100448938-100448960 CATTCTTTATGGGCTGTAGATGG - Intergenic
1090622021 11:128568584-128568606 CATTCATTATGGCCTCCTGAAGG + Intronic
1096829445 12:54302770-54302792 CATTCTTCATCCCCTCTGAGTGG - Intronic
1097160630 12:57044195-57044217 CAAGCTTCAGGGCCTCTGGGAGG + Exonic
1098037808 12:66323333-66323355 CATGCTTTCTGGCCTCTTGTTGG - Intronic
1099998478 12:89805960-89805982 CATTTTTTTTTTCCTCTGGGTGG + Intergenic
1102631043 12:114280002-114280024 CAGTTTTTATGGCCTCCTGGAGG - Intergenic
1103033890 12:117640785-117640807 AACTCTTTATGGTCACTGGGGGG + Intronic
1112037390 13:95509351-95509373 CCATCTTTATGGCCACAGGGAGG - Intronic
1121553028 14:94816431-94816453 CTTTCTTAATTGGCTCTGGGCGG - Intergenic
1122885413 14:104708339-104708361 CATCCTTTAGACCCTCTGGGAGG + Intronic
1123776735 15:23588064-23588086 CATTCTTGATGGCTGCTGAGGGG + Intronic
1126007625 15:44273333-44273355 CATGATTTATTTCCTCTGGGTGG - Intergenic
1126286465 15:47018543-47018565 CATCCTTCATGGAGTCTGGGAGG + Intergenic
1126566475 15:50106002-50106024 CATAATTAATGGCCTGTGGGTGG + Intronic
1128891714 15:71337628-71337650 AATTCTTACTGGGCTCTGGGAGG + Intronic
1129703730 15:77782831-77782853 ATTCCTTTCTGGCCTCTGGGTGG - Intronic
1130870200 15:87965498-87965520 CAGTCTCTATGGCAACTGGGTGG + Intronic
1135251642 16:20905381-20905403 CATTTATTTTGGGCTCTGGGCGG - Intronic
1135287340 16:21205497-21205519 CTTCCTTCATGGCCTCTGGCAGG + Exonic
1138108036 16:54301126-54301148 CTTCCTTTGTGGCCTCAGGGAGG - Intergenic
1144887144 17:18471053-18471075 CATTTATGATGGCCGCTGGGAGG + Intergenic
1145145072 17:20473242-20473264 CATTTATGATGGCCGCTGGGAGG - Intergenic
1146353866 17:32118128-32118150 CATTTATGATGGCCGCTGGGAGG + Intergenic
1148063923 17:44854943-44854965 CATTCTCTATGTCCTCTGCCAGG + Exonic
1151571337 17:74927368-74927390 CTCTCTTTATGTCCCCTGGGTGG + Intronic
1152281166 17:79385622-79385644 CATTCTGTGAGCCCTCTGGGTGG + Intronic
1155359786 18:24988560-24988582 CATCCTGTTTGGCCTCAGGGTGG + Intergenic
1156557931 18:38088453-38088475 CATTCTATATGGCATCACGGAGG - Intergenic
1160946120 19:1644837-1644859 CATTCTCCTGGGCCTCTGGGTGG - Intronic
1160948986 19:1656767-1656789 CATTCTTCCTGCCTTCTGGGAGG + Intergenic
1161257318 19:3316555-3316577 CAGACCTGATGGCCTCTGGGAGG + Intergenic
1161595991 19:5151253-5151275 CACTGTCTATGGCCTCTGAGAGG - Intronic
1161929009 19:7323655-7323677 CATTGTTTCTGGCCTCTGTCGGG - Intergenic
1161952356 19:7474882-7474904 CACTCCTTATGGGCCCTGGGGGG + Intergenic
1163648414 19:18503234-18503256 GTATCTTTATGGCATCTGGGAGG + Intronic
1167518459 19:49937779-49937801 AATCATTTCTGGCCTCTGGGCGG + Intronic
928655279 2:33444556-33444578 CATTATTTATGAGCTGTGGGTGG - Intronic
929234769 2:39594151-39594173 CATACTTCATGGCCTCTCAGAGG + Intergenic
932835418 2:75031319-75031341 CTTGCTTTCTGGCTTCTGGGAGG + Intergenic
935688354 2:105707035-105707057 CATTCTGTATGTCTTCTTGGAGG + Intergenic
935802730 2:106714863-106714885 CATGCTTTATGGAGCCTGGGGGG - Intergenic
938406713 2:131036892-131036914 CATTCTTCAGGGCCTCAGCGGGG + Intronic
939747333 2:145992118-145992140 CATTTTTTATGGCTCTTGGGAGG - Intergenic
940680483 2:156779061-156779083 ATTTCTTTATCTCCTCTGGGAGG - Intergenic
941660143 2:168187908-168187930 CATTAGTTATGGCCCCTGGAAGG + Intronic
944140842 2:196454775-196454797 CATGCTCTATGACCTCTGGAAGG + Intronic
944525868 2:200619111-200619133 CATCCTTTAAGGCATCTGAGCGG - Intronic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
945093754 2:206200112-206200134 CATTCTTAATGGCCTTTAGAAGG - Intronic
948288272 2:236804003-236804025 CATTCCTTGCGGCTTCTGGGTGG + Intergenic
948765202 2:240215877-240215899 CAGTCTTGAGGGCCTCTGGTGGG - Intergenic
1169773423 20:9226045-9226067 CATATTTTGTGGCCTGTGGGGGG + Intronic
1169922984 20:10755279-10755301 CATTGTCTATGGAGTCTGGGTGG + Intergenic
1170445923 20:16427603-16427625 TATTCTCTGTGGCCTCTGGGTGG - Intronic
1173019217 20:39253341-39253363 CGTTCTTTATGGGCTATGGAGGG - Intergenic
1180714821 22:17864704-17864726 CTTTCTCTATGGCCTGTCGGAGG - Intronic
1181978263 22:26747848-26747870 GATTCTGTAGGGCCTCTGGGTGG + Intergenic
949382699 3:3463983-3464005 CATTCTTCTTTGCCTATGGGTGG + Intergenic
949847335 3:8385044-8385066 CAGTCTTAATGGTCTGTGGGAGG + Intergenic
952090879 3:29884185-29884207 CATTCTGTATGGCAGCTGTGGGG - Exonic
957019514 3:75109352-75109374 CATCCTTTAGGGTTTCTGGGCGG - Intergenic
959558665 3:107753484-107753506 TTTTCCTTATTGCCTCTGGGAGG - Intronic
960420347 3:117437708-117437730 CATTCTTTCTGGCCCTTGGAAGG - Intergenic
967134564 3:186502559-186502581 CATTGTTTCTGGCCACTGTGGGG - Intergenic
968489210 4:881137-881159 CATTCTTTATCCCCTCTGGATGG - Intronic
972041059 4:34600334-34600356 CATTTTTTAAGGCCTGTGGTGGG - Intergenic
973634284 4:52847644-52847666 CTTTCTTTCTTCCCTCTGGGAGG - Intergenic
980908671 4:138974236-138974258 CAGTCTTTCTAGTCTCTGGGAGG + Intergenic
981013131 4:139946751-139946773 CATCCTTCCTGGCCTCAGGGAGG + Intronic
981570412 4:146145354-146145376 CATTCTTTATTGCCTCATGAAGG - Intergenic
993635643 5:90340207-90340229 CACCCTTTATGGCCTCTTTGGGG - Intergenic
996534196 5:124559410-124559432 CTTGCTTTATGGCTTCTGTGTGG - Intergenic
998773081 5:145568102-145568124 CTTTCTTTTTGGTCTTTGGGAGG - Intronic
998895689 5:146797490-146797512 CCATCTTTCTGGCCTCTGGAGGG + Intronic
999288109 5:150406309-150406331 CATTCTGCATGGGCTGTGGGAGG + Exonic
1000122842 5:158214017-158214039 CATTTTCTCTGGCCTATGGGAGG - Intergenic
1004540807 6:16547874-16547896 CATTGTTCATGGACACTGGGAGG + Intronic
1006422671 6:33945135-33945157 CCCTCTTTAGGGCCTCTGTGAGG + Intergenic
1007243946 6:40446647-40446669 TTTTCTTTCTGTCCTCTGGGAGG + Intronic
1008871567 6:56278445-56278467 CATTCTGTGTGGCCTGTGGAGGG + Intronic
1011094150 6:83639565-83639587 CTTTCTTAATGGCCTCAGGTGGG + Intronic
1011279230 6:85660366-85660388 CATTCCTGATGGTCTCTGCGTGG + Intergenic
1011451391 6:87496159-87496181 CATTCTTTCTGACCTCTGTTTGG - Intronic
1011807368 6:91087288-91087310 GATTCTTCATGGCCTCCTGGAGG + Intergenic
1011986312 6:93451115-93451137 CATTGTTTATTGTCTCTGTGGGG - Intergenic
1017563655 6:155660945-155660967 GATCCTTTATGTCTTCTGGGAGG - Intergenic
1025073623 7:55923510-55923532 CAATCTTTAGAGCCTCTGGAGGG - Intronic
1028425915 7:90688851-90688873 AATTCATTATGGCTTTTGGGTGG - Intronic
1032786878 7:135208061-135208083 CAGGCGTTTTGGCCTCTGGGAGG - Intronic
1032874829 7:136026949-136026971 CATACTTTATGGCATCGTGGGGG - Intergenic
1034959360 7:155355409-155355431 CAGCCTTTCTGCCCTCTGGGGGG - Intergenic
1037671062 8:21015828-21015850 AATTCTTTGGGGGCTCTGGGAGG - Intergenic
1038957318 8:32481781-32481803 CATTCTTTAAGGCAACTGGAAGG - Intronic
1039943658 8:42111949-42111971 CATTCTCTCTGGCCTCATGGGGG + Intergenic
1043483396 8:80675274-80675296 CATTCTTTCTGGCCTCCAAGAGG - Intronic
1050067668 9:1777723-1777745 CATTCGTAGTGACCTCTGGGTGG + Intergenic
1054716174 9:68559787-68559809 GATTGGTTAAGGCCTCTGGGTGG - Intergenic
1056713485 9:89010092-89010114 CCTTCTTTAGGGCCTCCTGGAGG - Intergenic
1057494070 9:95546200-95546222 CATCCTTTCTGGTCTGTGGGAGG - Intergenic
1059600371 9:115770696-115770718 CATTGTTTATGGTTTGTGGGAGG + Intergenic
1187638281 X:21258138-21258160 AATTATTTAAGGCCTCTTGGGGG + Intergenic
1189007332 X:37009580-37009602 CATTCTTGGGGGTCTCTGGGCGG - Exonic
1189905131 X:45751020-45751042 CTGTCTTTATGGGCTCTGAGTGG - Intergenic
1192822997 X:74664483-74664505 CATTTCTTATGGCCTCTTGGTGG - Intergenic
1194104492 X:89752357-89752379 CATTCTTTGTGTCCTCCTGGAGG - Intergenic
1196943883 X:120805245-120805267 CATTCATCATGCCCTCTTGGGGG - Intergenic
1200456448 Y:3400137-3400159 CATTCTTTGTGTCCTCCTGGAGG - Intergenic