ID: 924083217

View in Genome Browser
Species Human (GRCh38)
Location 1:240420889-240420911
Sequence TTGGATTTATTTGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 738
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 687}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924083213_924083217 18 Left 924083213 1:240420848-240420870 CCTGCTGTTAGTTCAGGTTCTAC 0: 1
1: 0
2: 0
3: 8
4: 78
Right 924083217 1:240420889-240420911 TTGGATTTATTTGGAAAAACAGG 0: 1
1: 0
2: 2
3: 48
4: 687

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924083217 Original CRISPR TTGGATTTATTTGGAAAAAC AGG Intronic
900534129 1:3168686-3168708 TTGGATTAATGTGCAAAAAATGG + Intronic
901367830 1:8768989-8769011 TAAAATTTATTTGTAAAAACAGG - Intronic
901732573 1:11290805-11290827 TTGTATTTCTTTGTAAAGACAGG - Intronic
902005293 1:13227024-13227046 TTGTATTTTTTTGGAGAGACAGG - Intergenic
902024571 1:13373121-13373143 TTGAATTTTTTTGGAGAGACAGG - Intergenic
903102469 1:21043718-21043740 TTGTATTTCTTTGTAGAAACTGG - Intronic
904061161 1:27711585-27711607 TTGTATTTTTTTGTAAATACTGG - Intergenic
904672060 1:32173425-32173447 TTGGAGTTCTTAGGGAAAACTGG - Exonic
904925042 1:34040951-34040973 TTGAAAGTTTTTGGAAAAACAGG - Intronic
905193365 1:36254229-36254251 AAGGACTTAGTTGGAAAAACTGG - Intronic
905981530 1:42233255-42233277 TAGGATTGATTTGGCAACACGGG + Intronic
905983458 1:42253493-42253515 TAGGATTGATTTGGCAACACGGG - Intronic
906190569 1:43896714-43896736 TTGTATTTTTTTGTAGAAACAGG + Intronic
908348498 1:63260568-63260590 TTGTATTTTTTTGTAGAAACAGG - Intergenic
908406019 1:63815047-63815069 TTTGATCTCTTTGGAAAAAAGGG + Intronic
908756813 1:67476434-67476456 ATTGATTTATTTGAAAAAATTGG + Intergenic
909059433 1:70863138-70863160 ATGGATTTATTTGCTAAAAGAGG + Intronic
909263242 1:73522001-73522023 TTGGATTTATTTGTTACAGCAGG - Intergenic
909547470 1:76863615-76863637 TTGTATTTTTTTGTAGAAACAGG + Intergenic
909555038 1:76944183-76944205 TTGGTTTTATCTGAGAAAACTGG + Intronic
909985574 1:82157075-82157097 TTGTATTTTTTTGTAAAGACAGG - Intergenic
910202272 1:84712133-84712155 TAGGATTTGTTTGGAAAACATGG - Intergenic
910447973 1:87318183-87318205 TTGGATATATTTTGAATATCTGG - Intergenic
910707128 1:90141627-90141649 TTGGATTTTTTTGGTAGAGCTGG - Intergenic
910965365 1:92802992-92803014 TTGTATTTTTTTGTAAAGACAGG - Intergenic
911026859 1:93445906-93445928 TTGGATTTTTTTGTAAAGATGGG - Intergenic
911242582 1:95482113-95482135 TTGGATTTTCTAGGATAAACAGG + Intergenic
911315942 1:96356919-96356941 TTGGATTTACACAGAAAAACTGG + Intergenic
911439079 1:97902459-97902481 TTGGATTTACTGGGTAAAACTGG + Intronic
911866117 1:103024301-103024323 ATTGATTTATTTGTAAAGACAGG + Intronic
912138643 1:106694122-106694144 TTGAATATATTGGGAAAAGCTGG - Intergenic
912336965 1:108872299-108872321 TTTTATTTTTTTGTAAAAACAGG + Intronic
913249902 1:116904584-116904606 ATGGCTTTATTATGAAAAACTGG - Intergenic
913376108 1:118154254-118154276 TTGCATCTATGTGGCAAAACAGG + Intronic
913433476 1:118821928-118821950 TTGGATGAATTTGGTAAGACTGG - Intergenic
914696038 1:150080730-150080752 GAGAATTTATTTGGTAAAACTGG - Intronic
915339856 1:155170979-155171001 TTGTATTTTTTTGGAGAGACAGG + Intronic
916334306 1:163653052-163653074 TTGAATCTATTTAGAAACACAGG - Intergenic
916957217 1:169851107-169851129 TTGGTTTTAATTGTAAAAACAGG - Intronic
916967958 1:169972759-169972781 TTTCATTTGTTTAGAAAAACAGG + Intronic
916969849 1:170001406-170001428 CTTGATTTAATTGGGAAAACAGG + Intronic
917721153 1:177787733-177787755 TTGGATTTGGTGGGAAAAAGGGG + Intergenic
917995512 1:180434691-180434713 TTGGTTTGGTTTGGAAAGACAGG - Intronic
918345761 1:183605867-183605889 TTGTATTTTTTTGTAAAGACGGG - Intergenic
918726248 1:187928179-187928201 TTGTTTTTATTTGGCAAAAAAGG - Intergenic
919196746 1:194296183-194296205 TTTGCTATATTTGGAAAAAGAGG + Intergenic
919298413 1:195731886-195731908 TTGTATTTATTTGTAGAGACAGG - Intergenic
919719646 1:200819416-200819438 TTGTATTTATTTGCTAAATCTGG + Intronic
920330625 1:205205052-205205074 TTGGATATACTTGGAAAAATGGG + Intronic
920656780 1:207882405-207882427 TGGGATTTATGTTGAAAGACTGG - Intergenic
921266704 1:213426394-213426416 GTGGATTTATTTGGGAAGGCTGG + Intergenic
921818216 1:219587669-219587691 ATTTATTTATTTTGAAAAACTGG - Intergenic
922020377 1:221698459-221698481 TTGGAATTAGGAGGAAAAACTGG - Intergenic
922173905 1:223179904-223179926 GTGGATTTATTTGGTAATAAAGG - Intergenic
922506046 1:226126298-226126320 TTGTATTTTTTTGTAAAGACAGG - Intergenic
923370223 1:233303340-233303362 TTGTATTTTTTTGTAAAGACAGG - Intergenic
923700987 1:236300466-236300488 ATGTATTTATTTGGAAAACGAGG - Intergenic
924083217 1:240420889-240420911 TTGGATTTATTTGGAAAAACAGG + Intronic
924757774 1:246957207-246957229 TTGTATTTATTAGTAAAGACGGG - Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063203218 10:3806054-3806076 CTGGAGTTATTTGTAAAAAATGG - Intergenic
1063213154 10:3899597-3899619 TTGTATTTTTTTGTAAACACAGG - Intergenic
1063647292 10:7897830-7897852 TTTGATTTATTTGTAGAGACAGG + Intronic
1064509424 10:16073769-16073791 TTGTATTTGTTTGTAAAGACAGG + Intergenic
1064764462 10:18656997-18657019 TTGTATTTTTTTGGAGAGACAGG + Intergenic
1065532012 10:26680542-26680564 TTGGATTTTTTTTTAAAGACAGG + Intergenic
1065709680 10:28503472-28503494 TTTGATTAATTAGGAAATACTGG + Intergenic
1066124239 10:32324108-32324130 TTGTATTTTTTAGTAAAAACAGG + Intronic
1066198110 10:33121429-33121451 TTGTATGTATGTGGAAAAATTGG - Intergenic
1067308357 10:45088995-45089017 TTTTATTTATTTTCAAAAACAGG + Intergenic
1067772378 10:49136092-49136114 TTGTATTTATTTGTTAAAAAAGG - Intergenic
1068528985 10:58163682-58163704 TTGTATTTTTTTGTAGAAACGGG - Intergenic
1068846821 10:61685731-61685753 TTGGATTTTTTTGTAGAGACAGG + Intronic
1069415453 10:68196654-68196676 TTGTATTTTTTTGTAAAGACGGG + Intronic
1069439616 10:68416291-68416313 TTGTATTTTTTTGTAAAGACAGG - Intronic
1069459552 10:68581668-68581690 TTGTATTTTTTTGGAGAAACGGG - Intronic
1069775746 10:70926152-70926174 TTGCATTTATTTGCTAAATCTGG - Intergenic
1069926645 10:71855277-71855299 TTGCATTTTTTTGTAAAGACAGG - Intergenic
1070031068 10:72677921-72677943 TTGTATTTTTTTGTAGAAACGGG - Intergenic
1070131309 10:73657341-73657363 TTGTATTTTTTTGTAGAAACAGG - Intronic
1070606864 10:77904755-77904777 TTTTTTTTATTTGGAAGAACAGG - Intronic
1070721822 10:78762220-78762242 TTACATTTATTTGGTAAAAAAGG + Intergenic
1071600598 10:86957026-86957048 ATTGATTTCTTTGGAAGAACAGG + Intronic
1072762559 10:98068935-98068957 TTGGATTTACTTTGGAAGACAGG - Intergenic
1073273121 10:102283806-102283828 TCGGAGTTCTTTGGAAACACAGG - Intronic
1073474908 10:103746491-103746513 TTGTATTTTTTTGTAGAAACTGG + Intronic
1073490276 10:103848669-103848691 TAGGATTTAGATGGGAAAACTGG - Intronic
1073971972 10:109054087-109054109 TTTTATTTATTTGGTAAAATAGG - Intergenic
1074210921 10:111334251-111334273 TTGGAGATATTTAGAAAAAGAGG - Intergenic
1075313448 10:121433359-121433381 TTGGATTCACTTGGGAGAACTGG - Intergenic
1076226963 10:128785230-128785252 TTGGATATATATGCAGAAACAGG + Intergenic
1077940565 11:6836927-6836949 TTGGATATATTTCTAAAAGCAGG + Intergenic
1077990078 11:7399149-7399171 TTCAAGTTATTTGGAGAAACTGG + Intronic
1078124151 11:8542880-8542902 TTGTATTTTTTTGTAGAAACGGG + Intronic
1078590790 11:12639146-12639168 TTGGGTTTATTTAGAAAAGAAGG + Intergenic
1078615144 11:12857911-12857933 TTGTATTTTTTTGTAAAGACAGG - Intronic
1078633173 11:13023878-13023900 TTTGGTTAATTTGAAAAAACTGG + Intergenic
1079396490 11:20068039-20068061 GTGTATTTCTCTGGAAAAACTGG - Intronic
1079782002 11:24618773-24618795 TTGTATTTACTGGGAGAAACAGG + Intronic
1080361908 11:31524810-31524832 TTGTATTTTTTTGTAGAAACAGG - Intronic
1080494190 11:32799399-32799421 TTGTATTTATTTGTATAGACAGG + Intergenic
1080666970 11:34344667-34344689 TTGTATTTTTTTGTAGAAACGGG + Intronic
1081592423 11:44433808-44433830 TTGAATTAATTTGGAAAACAAGG + Intergenic
1081802356 11:45868805-45868827 TTGTATTTTTTTGTAGAAACTGG + Intronic
1083501253 11:63110309-63110331 TAGGATTTATTTGGCAATGCGGG + Intronic
1084167151 11:67380602-67380624 TTGTATTTCTTTGTAGAAACAGG + Intronic
1084187120 11:67479475-67479497 TTTGATTTATTTGTAGAGACAGG + Intergenic
1084258721 11:67960049-67960071 TTGTATTTTTTTGTAAAGACAGG - Intergenic
1084761960 11:71279293-71279315 TTGGAATTACTTGAAAATACAGG - Intergenic
1087111864 11:94478640-94478662 TTGTATCTGTTTGGAAAAAATGG - Intronic
1087413131 11:97817747-97817769 TTGTATTTTTTTGTAAAGACGGG + Intergenic
1087462843 11:98466974-98466996 TGGAATTTATTGGGAAAAAAGGG - Intergenic
1087520288 11:99224869-99224891 ATGTATTTATTTTGAAAAACTGG + Intronic
1088224761 11:107607483-107607505 TTGTATTTTTTTGTAGAAACAGG - Intronic
1088236531 11:107730976-107730998 TTGTATTTTTTTGTACAAACAGG + Intergenic
1088494853 11:110422543-110422565 TTGCCTTTACTTGGAAAAAATGG + Intergenic
1088650342 11:111952513-111952535 TTGGATTTTTTTGTAGAGACAGG - Intronic
1088673835 11:112171090-112171112 TTGAAAATATTTGGAAAAAAAGG + Intronic
1089056907 11:115592967-115592989 TTGGAATTGTCTAGAAAAACAGG + Intergenic
1089084425 11:115805042-115805064 GTGTCTTTATTTGTAAAAACAGG - Intergenic
1090212005 11:124927535-124927557 TTGTATTTTTTTGTAGAAACGGG + Intronic
1091149804 11:133317427-133317449 TTCGACTTATTTTGAAACACTGG + Intronic
1091432121 12:445243-445265 TTGTATTTTTTTGTAAAGACAGG + Intergenic
1091486310 12:892397-892419 TAGAATTTATTTACAAAAACAGG + Intronic
1092010333 12:5104896-5104918 ATGGATTTATTTAGACACACTGG + Intergenic
1092187914 12:6494775-6494797 TGGGCTTTATCTGTAAAAACAGG - Intronic
1092650811 12:10632717-10632739 TTGGGTTTATTTTGAAAATAGGG + Intronic
1093774875 12:23061955-23061977 TTGGATTTATATCCAAAAATAGG + Intergenic
1093828982 12:23731726-23731748 TTGGATTCCTTTGCTAAAACTGG + Intronic
1094082539 12:26553395-26553417 TTAGATTTATTTGAGAAAGCAGG + Intronic
1094621926 12:32088150-32088172 TGTGATTTTTTTGAAAAAACAGG - Intergenic
1095750592 12:45706376-45706398 ATTTATTTATTTTGAAAAACTGG + Intergenic
1095772714 12:45979392-45979414 ATGGATTTAATAGGAAAAAAGGG + Intronic
1095809085 12:46352917-46352939 TTGTATTTTTTTGTAAAGACGGG - Intergenic
1095852591 12:46827103-46827125 TTAGATTTATTGGGAACAATAGG + Intronic
1095965713 12:47865582-47865604 TTTGATTTTTTTGTAAAAATGGG + Intronic
1095988664 12:48018133-48018155 CTCTACTTATTTGGAAAAACAGG - Intergenic
1096141945 12:49249686-49249708 TTGTATTTATTTGGAAGAGACGG - Intronic
1097451075 12:59737636-59737658 TTGCTTTTATTTGAAAAGACTGG + Intronic
1097826418 12:64179013-64179035 TTGGAGTTATTTTTAAAGACAGG - Intergenic
1098157207 12:67612103-67612125 TTGGATTTATTTCTAAAACCTGG - Intergenic
1098258415 12:68642228-68642250 GAGCATTTATTTGTAAAAACTGG - Intronic
1098430763 12:70417615-70417637 ATGGATGTATTTGCATAAACAGG - Intronic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1098720600 12:73892627-73892649 TTGTATTTATTTGGTAAAGATGG + Intergenic
1098845688 12:75533007-75533029 TAAGATTTATTTGGCAAAATGGG + Intergenic
1098884646 12:75948410-75948432 TTTGATTTATTTGGGGAAAATGG - Intergenic
1098891893 12:76017820-76017842 TTTGATTTATCTGTAACAACAGG + Intergenic
1098953891 12:76669007-76669029 TTGGATTTTTTTGTAGAGACAGG + Intergenic
1099359195 12:81678143-81678165 TTGCATCTAGTTGGAAAGACAGG + Intronic
1099557060 12:84122935-84122957 TTGGTTTGATTTGGAAACAAAGG + Intergenic
1100018193 12:90037657-90037679 TTAGATTAAATTGGAAAAGCTGG + Intergenic
1100485714 12:95024741-95024763 TTGTATTTTTTTGTAGAAACAGG + Intronic
1100816080 12:98388550-98388572 TTGGATTTATTTATAACAACAGG + Intergenic
1100867381 12:98871192-98871214 TGGGATTGATTTAGAAAAAAAGG - Intronic
1100986989 12:100211442-100211464 TTGTATTTTTTTGTAGAAACAGG + Intronic
1101132602 12:101704700-101704722 TTTAATGTATTTTGAAAAACAGG - Intronic
1101132677 12:101705362-101705384 TTTAATGTATTTTGAAAAACAGG - Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1103123634 12:118401836-118401858 TTTGATTTATTTGAAAACTCAGG + Intronic
1103309435 12:119992683-119992705 TTTGATTTAATTGAAAATACAGG - Intronic
1103506976 12:121448145-121448167 TTGTATTTTTTTGTAAAGACAGG - Intronic
1103572631 12:121855140-121855162 ATGCATTTATTTAGCAAAACTGG + Intronic
1103967549 12:124649625-124649647 TTGTATTTTTTTGTAGAAACGGG + Intergenic
1105670553 13:22609687-22609709 TTGGTTTTAGTGGGAAAAAATGG + Intergenic
1105808687 13:23974478-23974500 TAACATTCATTTGGAAAAACAGG - Intergenic
1106792802 13:33172882-33172904 TTGAATTTCTATGGACAAACTGG + Intronic
1107060300 13:36153317-36153339 TTTAAGTTTTTTGGAAAAACAGG + Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107697979 13:43019205-43019227 TTGGAAATATTTGATAAAACAGG - Intergenic
1107768686 13:43766186-43766208 TTGCATTTATCTGGAAAAACAGG + Intronic
1107832267 13:44385105-44385127 TCTGTTTTATGTGGAAAAACAGG + Intronic
1108242369 13:48479053-48479075 TTGGATTTTTTTGTAAAGATGGG - Intronic
1108500328 13:51064576-51064598 TTGGATTGATGTTGAATAACGGG - Intergenic
1108748282 13:53418579-53418601 TTTAATTTATTTGGAAAACCTGG + Intergenic
1108927640 13:55772446-55772468 TTGGATTTTTTGGGGAAAATAGG + Intergenic
1109076029 13:57836202-57836224 TTGGTTCGATTTGGAAAAGCAGG - Intergenic
1109417031 13:62053358-62053380 TTTAATTTATTTGAAATAACAGG + Intergenic
1110413327 13:75226493-75226515 TGGGATTTATTGGGCAAAAAAGG - Intergenic
1110954302 13:81534703-81534725 TTAGAGTTAATAGGAAAAACAGG - Intergenic
1111202228 13:84954048-84954070 TTGAATTTATTGGGCAAAAAGGG + Intergenic
1111561707 13:89958631-89958653 TTGGAATGATTAGCAAAAACTGG + Intergenic
1111933871 13:94539039-94539061 TTGGAGTTCTTTGGAAATGCAGG - Intergenic
1112476261 13:99733609-99733631 TTGGACTAATTTGGAAAATATGG + Intronic
1112715610 13:102181425-102181447 GTGCCTTTATTTGGAAAAAGGGG + Intronic
1112829149 13:103427378-103427400 TTGGATTGCTCTGGAAACACTGG + Intergenic
1112886615 13:104181505-104181527 TTGGTTTGGTCTGGAAAAACAGG + Intergenic
1113543462 13:111127031-111127053 GTGGACTGATTAGGAAAAACGGG + Intronic
1114219871 14:20686634-20686656 TTGTCTTTGTTTGGAAATACAGG + Intronic
1114253523 14:20982009-20982031 TTTAATTTTTTTGGAAAAATGGG - Intergenic
1115144404 14:30209842-30209864 TTAAATTTATTTGGAAAATAAGG + Intergenic
1115283573 14:31692054-31692076 TAGGATCTATTAGGAAAAATAGG + Intronic
1115385034 14:32787829-32787851 TTGCATATATTTGAAAAAAATGG - Intronic
1115962213 14:38848100-38848122 TTCTGTTTCTTTGGAAAAACTGG - Intergenic
1116390984 14:44388958-44388980 TTCAATTTTTTTTGAAAAACAGG + Intergenic
1117056800 14:51920474-51920496 TTGAAAATATTTGGAAAAAATGG - Intronic
1117302783 14:54444984-54445006 TGGGATTCATCTGGAAAAAGGGG - Intergenic
1117506119 14:56404842-56404864 TTGTATTTTTTAGTAAAAACAGG + Intergenic
1117932581 14:60859185-60859207 GTGGATTTATTTGGAGACCCAGG + Intronic
1118855923 14:69622337-69622359 TTGGATTTTTTTGCAGAGACGGG + Intronic
1119012093 14:71004082-71004104 TTTTATTTATTTACAAAAACAGG - Intronic
1119035896 14:71230602-71230624 TTTGATTTTTTTGTAAAGACAGG + Intergenic
1119064236 14:71509935-71509957 CTGGGTTTTTTTGGAAACACTGG + Intronic
1119209918 14:72823940-72823962 GTGGATGCATTTGGACAAACAGG + Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1120199627 14:81522927-81522949 TTGAAAATATTTGGAAAAAATGG - Intronic
1120683833 14:87513869-87513891 TTGTATTTTTTTGTAAAGACAGG - Intergenic
1121131908 14:91454997-91455019 TTGTATTTTTTTGTAAAGACTGG - Intergenic
1121905927 14:97744512-97744534 TTGCAACAATTTGGAAAAACTGG - Intergenic
1121919808 14:97870097-97870119 TTGGATTCATTTGGAGGAAAAGG + Intergenic
1122168171 14:99846625-99846647 TTAGCTGTATTTGGAAAAATGGG - Intronic
1122995122 14:105259270-105259292 TTGGATTTTTTTGTAGAAACAGG - Intronic
1123073824 14:105656172-105656194 TTGGTTTGGTTTGGAAAAGCAGG - Intergenic
1123087828 14:105725751-105725773 TTGGTTTGGTTTGGAAAAGCAGG - Intergenic
1202833631 14_GL000009v2_random:61563-61585 TATGATTTATTTTGAAAAAGAGG - Intergenic
1202906887 14_GL000194v1_random:79549-79571 TAAGATTTATTTCGAAAAAGAGG - Intergenic
1123688181 15:22815101-22815123 ATGGATTTTTTTTTAAAAACAGG - Intronic
1123825976 15:24082515-24082537 TTTGAAGAATTTGGAAAAACAGG - Intergenic
1124248673 15:28094029-28094051 TAGGATGTGTTTGGAAGAACTGG - Intronic
1125800550 15:42443037-42443059 TTGTATTTATTTGTAGAGACAGG + Intronic
1125876780 15:43155054-43155076 TTGTATTTTTTTGTAAAGACAGG - Intronic
1125911275 15:43441921-43441943 TTGTATTTTTTAGGAAAGACAGG + Intronic
1126375456 15:47992474-47992496 TTGTATTTATTTGTAAAGATGGG - Intergenic
1126429775 15:48570235-48570257 TAGGATTAGTTTGGAAAAAATGG - Intronic
1126628430 15:50708858-50708880 TTGTATTTTTTTGTAGAAACGGG - Intronic
1126636052 15:50780812-50780834 TTGTATTTTTTTGGAGAGACAGG + Intergenic
1126728683 15:51658662-51658684 TTTGTTTTTTTTAGAAAAACAGG + Intergenic
1126820788 15:52501426-52501448 TTGTATTTTTTTGTAGAAACGGG - Intronic
1127611933 15:60645562-60645584 TTGTATTTTTTTGTAAAGACGGG + Intronic
1128127329 15:65202734-65202756 TTGCTTTTATTGGGAAAAGCAGG + Intronic
1128424222 15:67522701-67522723 TCGAAATTATTTGGAAAGACTGG + Intronic
1128472051 15:67962660-67962682 TTGTATTTTTTTGTAGAAACAGG - Intergenic
1128499219 15:68215641-68215663 TTTAAATTATTTGTAAAAACAGG + Intronic
1129084228 15:73071685-73071707 TTGTATTTATTTGTAGAGACAGG + Intronic
1129257716 15:74343577-74343599 TTAGATTTTTCTGGAAAAAGAGG - Intronic
1129752425 15:78075716-78075738 TTGGTTTTCTTTGGGGAAACAGG + Intronic
1130038602 15:80384368-80384390 TTGGACTTATATGTAAAGACAGG + Intronic
1130796542 15:87215650-87215672 TAGCTTTTATTTGGAAATACAGG - Intergenic
1130814086 15:87412156-87412178 TTAGATTTGTTTGGATAAAAAGG - Intergenic
1132064578 15:98720141-98720163 TTGCATTTATTTAGATACACTGG - Intronic
1133694380 16:8247631-8247653 TTGGATTCATCAGGACAAACAGG - Intergenic
1134758730 16:16694324-16694346 TTGTATTTATTTTGATCAACTGG + Intergenic
1134987345 16:18664847-18664869 TTGTATTTATTTTGATCAACTGG - Intergenic
1135358355 16:21789860-21789882 TTAGACTCATTTGGGAAAACAGG - Intergenic
1135456858 16:22605985-22606007 TTAGACTCATTTGGGAAAACAGG - Intergenic
1136333656 16:29597408-29597430 TTGTATTTTTTTGTAGAAACGGG - Intergenic
1136633856 16:31506931-31506953 CTGGATTTTTTTGAGAAAACAGG - Intronic
1137004198 16:35257376-35257398 TTGTATGTCTTTGGAAAAAATGG - Intergenic
1137336983 16:47559372-47559394 TTGGGTTTATTTGCAACAATAGG - Intronic
1137470353 16:48749653-48749675 TTTGATTAATTCTGAAAAACTGG - Intergenic
1137728792 16:50674673-50674695 TTGGCTTTACTTGCTAAAACTGG + Intronic
1137855814 16:51793604-51793626 TTGAATTGCTTTGGGAAAACTGG - Intergenic
1138257586 16:55580248-55580270 TTGAGTTCATTTGAAAAAACAGG + Intronic
1138468371 16:57210843-57210865 TTGGATTTTTTTGTAGAAACAGG - Intronic
1138508050 16:57488080-57488102 TTGGATTTTTTTGTAGAGACAGG + Intergenic
1138528887 16:57624326-57624348 TTGTATTTTTTTGGAGAGACAGG - Intronic
1138904269 16:61311337-61311359 TCAGATTTATTTGGACAAACAGG + Intergenic
1139089091 16:63621892-63621914 TTGGCTTTATTTTGAAAAAAAGG + Intergenic
1139109476 16:63872095-63872117 TTGGATTTATTTGTTAAATTAGG - Intergenic
1139277513 16:65741576-65741598 TTGTATTTTTTTGTAGAAACGGG - Intergenic
1139726682 16:68905698-68905720 TTGTATTTTTTTGTAGAAACCGG - Intronic
1139739199 16:69020726-69020748 TTTGATTTTTTTGTAGAAACAGG - Intronic
1139806713 16:69571933-69571955 TTGGATTTTTTAGTAGAAACAGG + Intronic
1139811104 16:69617661-69617683 TTGTATTTTTTTGTAAAGACAGG + Intronic
1140085739 16:71794876-71794898 TTGTATTTAGTGGGAAAAATAGG - Intronic
1140096169 16:71877429-71877451 TTGTATTTTTTTGAAAAAACGGG + Intronic
1140203008 16:72909703-72909725 TTGTATTTTTTTGTAGAAACAGG - Intronic
1141041598 16:80677141-80677163 TTGTATTTTTTTGGAGAGACAGG + Intronic
1141083327 16:81072872-81072894 TTGTATTTTTTTGTAGAAACAGG + Intronic
1141556483 16:84839816-84839838 TTGGATTTTTTTGTAGAGACGGG - Intronic
1141755078 16:85985584-85985606 TGGGCTTAATTTGGAAAACCTGG + Intergenic
1141942637 16:87288204-87288226 ATACAATTATTTGGAAAAACAGG + Intronic
1142224903 16:88872571-88872593 GAGGATCTATTTGGAAAAACTGG + Intergenic
1142576938 17:915454-915476 TTGTATTTTTTTGTAAAGACTGG + Intronic
1143087862 17:4430081-4430103 TTGGATTTTTTAGTAAAGACGGG + Intergenic
1143314363 17:6020903-6020925 TTGGATTTTTTTGGATCACCAGG + Intronic
1143771969 17:9174714-9174736 TTGGATGTATTTGGACATAGGGG - Intronic
1144109350 17:12017288-12017310 CTGAATTTAATTGGAAATACAGG - Intergenic
1144318561 17:14089219-14089241 TTATTTTTCTTTGGAAAAACTGG - Intronic
1144748983 17:17635145-17635167 TTATATTTTTTTGTAAAAACAGG + Intergenic
1145405294 17:22585055-22585077 TGGGATTTATTGGGAAAAAAGGG + Intergenic
1145721910 17:27081716-27081738 TTTTATTTATTTGTAGAAACGGG - Intergenic
1146107841 17:30058478-30058500 TTTGATTTAGTAGGAAGAACTGG - Intronic
1146408592 17:32562166-32562188 TTGTATTTTTTTGTAGAAACGGG + Intronic
1146733159 17:35213068-35213090 TTGTATTTTTTTGTAGAAACGGG - Intergenic
1148224224 17:45887217-45887239 TTGCATTTTTTTGCAGAAACGGG + Intergenic
1149102325 17:52921867-52921889 TGGAATTTATTGGGAAAAAAAGG + Intergenic
1149254571 17:54810492-54810514 TTGAGTTTATTTTGAAAAATTGG - Intergenic
1149588877 17:57812729-57812751 TTGTATTTTTTTGTAAAGACAGG + Intergenic
1149935177 17:60797867-60797889 TTGTATTTTTTTGCAGAAACGGG - Intronic
1150098826 17:62403819-62403841 TTGTATTTTTTTGTAAAGACAGG + Intronic
1150720012 17:67606449-67606471 TTGGAGCTCTTTGGAAAAGCTGG - Intronic
1151009906 17:70482656-70482678 TTGGATTTTTTTGTAAAGATGGG - Intergenic
1152482164 17:80561602-80561624 TTGTATTTTTTTGTAGAAACAGG + Intronic
1153537047 18:6113610-6113632 TTTGCTTTATTTGGTAAAAATGG + Intronic
1154423565 18:14254997-14255019 TATGATTTATTTTGAAAAAGAGG - Intergenic
1155177746 18:23315628-23315650 TTTCATATATTTGGGAAAACTGG + Intronic
1155204636 18:23547567-23547589 TTGTATTTGTTTGTAGAAACAGG - Intronic
1155294602 18:24373716-24373738 TTGTCATTATTTGGAAAAACAGG + Intronic
1158244448 18:55415271-55415293 TTGTTTTTATTTGGAAATAAAGG - Intronic
1158915501 18:62122825-62122847 TTGTATTATTTTGGAAAAAGAGG - Intronic
1159325294 18:66907255-66907277 TTGGATTTAGTTGAAATAATAGG + Intergenic
1159537751 18:69736583-69736605 TTGCATTTATTTTGTGAAACAGG - Intronic
1159874493 18:73795305-73795327 TTGGGTGAATTTGGAAAAATAGG - Intergenic
1159875123 18:73802313-73802335 TAGGATTTATATTTAAAAACAGG + Intergenic
1161624537 19:5318656-5318678 TTGTTTTTATTTTGAAAGACAGG + Intronic
1162865890 19:13546674-13546696 TGGGATAAATTTGGAGAAACTGG - Intronic
1163170586 19:15528279-15528301 TTTAATTTTTTTGTAAAAACTGG - Intronic
1163351961 19:16782697-16782719 TTGAAAATATTTGGAAAAGCTGG + Intronic
1164139312 19:22443278-22443300 TTGTATTTTTTTGTAGAAACGGG + Intronic
1165593337 19:36989724-36989746 TTGGATTTTTTTGTAGAAACGGG + Intronic
1165691945 19:37870449-37870471 TTGGTTTGATTTGGGAAGACTGG + Intergenic
1167091629 19:47348429-47348451 TTGTATTTTTTTGTAGAAACAGG + Intergenic
1168608464 19:57778635-57778657 ATGGAATTATTTGCACAAACAGG - Intronic
1202635140 1_KI270706v1_random:37932-37954 TAAGATTTATTTTGAAAAAGAGG + Intergenic
1202639036 1_KI270706v1_random:66129-66151 TATGATTTATTTTGAAAAAGAGG + Intergenic
925868283 2:8247694-8247716 TTGAATATATTTGGAAACAGAGG - Intergenic
925996806 2:9300058-9300080 TTGTATTTTTTTGTAGAAACAGG - Intronic
926079470 2:9972749-9972771 TTGTACTTGTTTGGAACAACAGG + Intronic
926635783 2:15177686-15177708 TTGGATTTATAAGAAAAAACTGG + Intronic
927599867 2:24431434-24431456 TTGTATTTTTTTGTAAAGACAGG + Intergenic
927691144 2:25209168-25209190 TTGTATTTTTTTGTAAAGACGGG - Intergenic
929342064 2:40831996-40832018 TGGGAATGATTTAGAAAAACAGG + Intergenic
929477311 2:42264287-42264309 TTGTATTTTTTTGTAAAGACAGG + Intronic
929539233 2:42807448-42807470 TTGCATTTTTTTTAAAAAACTGG - Intergenic
929637659 2:43541679-43541701 TTGTATTTTTTTGTAAAGACAGG + Intronic
929682273 2:44003632-44003654 TTGTATTTTTTTGTAGAAACGGG + Intergenic
929780046 2:44951711-44951733 GTGGTTTTATTTGTAAAAAGTGG - Intergenic
930169189 2:48233626-48233648 TTGTATTTTTTTGTATAAACAGG - Intergenic
931235904 2:60412523-60412545 ATAGATTTATTGGGAAAAAAAGG - Intergenic
931511295 2:62998455-62998477 TTCCATTTGTTTGGAAAAAAAGG - Intronic
931923298 2:67044165-67044187 TTGGCTTTATTTAGAGAAGCTGG + Intergenic
931989669 2:67777280-67777302 TTGCATTTATCTGGAACAAATGG - Intergenic
932136646 2:69236869-69236891 GTGGATTTATTTACAAAAATGGG - Intronic
932157360 2:69430383-69430405 TTGTATTTTTTTGTAAAGACAGG + Intronic
932232280 2:70092856-70092878 TTGTATTTTTTTGTAGAAACAGG + Intergenic
932883029 2:75522044-75522066 TTGCATTTATTTTTAAAAATTGG + Intronic
933220089 2:79678368-79678390 TTGGATTTTTTTGTAGAGACAGG - Intronic
934494508 2:94785707-94785729 TTTGATTCATTTTGAAAAAGAGG + Intergenic
934512725 2:94959886-94959908 TTGGCATTATTTCTAAAAACTGG - Intergenic
934697286 2:96409075-96409097 TTGTATTTTTTTGGAGAGACGGG - Intergenic
935004585 2:99059739-99059761 TTGCATTTTTTTGTAGAAACGGG - Intronic
935322633 2:101903846-101903868 TTGAATTTTTTTTGAGAAACAGG + Intergenic
935446100 2:103158490-103158512 TTGTATTTTTTTGGAGAGACGGG - Intergenic
935724479 2:106011080-106011102 TGGGATTTATTGGGAAAAAAGGG - Intergenic
935756120 2:106277259-106277281 TTGTATTTTTTAGGAAAGACGGG - Intergenic
935787555 2:106562771-106562793 TTTGACTTATTTGGAAAAGAAGG + Intergenic
935827516 2:106966280-106966302 TGGGCTTTATTTCCAAAAACAGG + Intergenic
936664931 2:114583727-114583749 TTGGATTTATTTAAAATAGCAGG - Intronic
937643868 2:124244244-124244266 TTGGAATCATTTAGAAACACAGG - Intronic
937725210 2:125156429-125156451 TTGTATTTGTTTGTAGAAACAGG + Intergenic
938225183 2:129609721-129609743 TTGGAATTATGTTGAAAAAGAGG + Intergenic
939089841 2:137767074-137767096 TTTGCATTATTTGGGAAAACTGG + Intergenic
939338087 2:140857138-140857160 TTTGAATTTATTGGAAAAACTGG - Intronic
939350535 2:141032119-141032141 TTGGATATACTTGCAAAAATAGG + Intronic
939372400 2:141318107-141318129 TAGGATTTATGTTGAACAACTGG + Intronic
939499254 2:142961738-142961760 TAGTATTTATTTGAAAAAAAAGG + Intronic
939524935 2:143281258-143281280 TTTGATGTATTTTGAAAATCTGG - Intronic
939699688 2:145374844-145374866 TTTTATTCATTTGGGAAAACAGG + Intergenic
940187168 2:150998558-150998580 TTGGATTTATTTAATAAAAGGGG + Intergenic
940351310 2:152692429-152692451 TTGAATTTATTTTGAAAAGTTGG - Intronic
940455812 2:153898463-153898485 TTCAATTTAATTGGATAAACTGG - Intronic
940968698 2:159870276-159870298 TTGTATTTTTTTGTAGAAACGGG - Intronic
941139729 2:161764558-161764580 TTAGTTTTATTTTGTAAAACTGG + Intronic
941249958 2:163148863-163148885 TGGGATTTATTGGGCAAAAAGGG - Intergenic
941569352 2:167150467-167150489 TTGGTTTTATTAGAAAAAAATGG + Intronic
941687642 2:168463734-168463756 TTGTATTTTTTTGTAAAGACGGG - Intronic
941799022 2:169634231-169634253 TTGTATTTTTTTGTAAAAATGGG + Intronic
941928548 2:170918867-170918889 TTGGTTTGATGTGGAAGAACAGG + Intergenic
942001105 2:171647617-171647639 TTGTATTTTTTTGTAAAGACAGG + Intergenic
942223593 2:173795098-173795120 TTGAATTATTTTGGAAAAATTGG + Intergenic
942575717 2:177361520-177361542 TTGTATTTTTTTGTAAAGACAGG - Intronic
942962305 2:181845840-181845862 TTGTATTTTTTTGTAAAAACAGG + Intergenic
943340567 2:186675752-186675774 TTATATTTATTTGAAAACACTGG - Intronic
943778301 2:191792490-191792512 TTGGAGTATTTTGGAAAGACTGG + Intergenic
944070609 2:195663962-195663984 TTCACTTTATTTGGAAAAAACGG - Intronic
944097679 2:195987626-195987648 GTGGATTTATATGGAAAATATGG - Intronic
945806440 2:214495729-214495751 TTGGATTTCTTTAGAAAAAATGG - Intronic
946714206 2:222535959-222535981 TTTTATTTATTTGGGAAAAGTGG - Intronic
947177845 2:227385350-227385372 TTGTATTTTTTTGTAGAAACAGG - Intergenic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
949060775 2:241955885-241955907 TTGGTTTGATCTGGAAAGACGGG + Intergenic
1169289341 20:4335325-4335347 TGGGTTTGTTTTGGAAAAACAGG - Intergenic
1169585334 20:7076139-7076161 TTGGAAACATTTGGAAAACCTGG + Intergenic
1170568480 20:17619947-17619969 TTAGATTTACTTGCAAAAGCAGG + Intronic
1171763709 20:29237007-29237029 TAGGATTGATTTGGAAATGCGGG - Intergenic
1171881290 20:30619113-30619135 TATGATTTATTTTGAAAAAGAGG + Intergenic
1171985454 20:31657504-31657526 TTGTATTTTTTTGTAAAGACGGG + Intergenic
1172910304 20:38404032-38404054 TTGGAATTAACTAGAAAAACTGG - Intergenic
1172978622 20:38924856-38924878 TTGTATTTTTTTGTAAAGACAGG + Intergenic
1173508674 20:43608731-43608753 TTGTATTTTTTTGTAAAGACAGG - Intronic
1173957961 20:47049326-47049348 ATGGATGTTTCTGGAAAAACTGG - Intronic
1174384669 20:50180046-50180068 TTGGATTTTTTTGTATAGACGGG + Intergenic
1174633382 20:51977930-51977952 GTGACTTTATTTGGAAAAAAAGG + Intergenic
1176601733 21:8800378-8800400 TAAGATTTATTTTGAAAAAGAGG + Intergenic
1176626237 21:9094350-9094372 TAAGATTTATTTTGAAAAAGAGG - Intergenic
1176849910 21:13905011-13905033 TATGATTTATTTTGAAAAAGAGG + Intergenic
1177531778 21:22370032-22370054 TTGTATTTATTTGTAGAGACAGG + Intergenic
1177687931 21:24464594-24464616 TTGTATGAGTTTGGAAAAACAGG + Intergenic
1177787270 21:25684767-25684789 TTGTATTTTTTTGTAGAAACAGG + Intronic
1178081053 21:29065468-29065490 TTGCATTTAATGGGAAAAGCTGG + Intronic
1178221619 21:30667321-30667343 TAGGACTTATTTAGAAAAATAGG - Intergenic
1178417448 21:32415298-32415320 TTCCCTTTATTTAGAAAAACAGG - Intronic
1178531893 21:33382806-33382828 TTGTATTTTTTTGGAAAGATAGG - Intergenic
1178644182 21:34371628-34371650 TTGTATTTTTTTGTAAAAACAGG + Intergenic
1178698210 21:34812125-34812147 TTTGAATTATTTGGAATAATTGG + Intronic
1180202929 21:46237567-46237589 TTGTATTTTTTTGTAGAAACGGG + Intronic
1180344019 22:11691929-11691951 TAAGATTTATTTTGAAAAAGAGG + Intergenic
1180362912 22:11915734-11915756 TATGATTTATTTTGAAAAAGAGG - Intergenic
1180365567 22:11935295-11935317 TAAGATTTATTTTGAAAAAGAGG - Intergenic
1180393671 22:12309210-12309232 TTGGATTTGTCTGGAAAAAAAGG + Intergenic
1180406078 22:12555542-12555564 TTGGATTTGTCTGGAAAAAAAGG - Intergenic
1181679420 22:24482773-24482795 TTGCATGAATTTGTAAAAACCGG - Intergenic
1181834862 22:25596098-25596120 TAGGAATTGTATGGAAAAACTGG + Intronic
1182076039 22:27496118-27496140 TTGAATTTATTTTGAATAATGGG - Intergenic
1182297964 22:29320975-29320997 TTGCATTTCTTTGTAGAAACAGG + Intergenic
1182736307 22:32533963-32533985 GTGGATTCACATGGAAAAACAGG + Intronic
1182912915 22:34002356-34002378 TTGTATTTTTTTGGAGAGACAGG - Intergenic
1182990002 22:34758421-34758443 TGGGATTCATTTTGAAGAACTGG + Intergenic
1183159110 22:36098995-36099017 TTGTATTTTTTTGTAACAACAGG + Intergenic
1184328316 22:43809164-43809186 TTTGATTCATCTGGAAAAATAGG - Intronic
1184705024 22:46205389-46205411 TTGTATTTATTTGTAGAGACGGG + Intronic
1185217761 22:49612453-49612475 CTAGATTTAAATGGAAAAACTGG - Intronic
949200997 3:1379279-1379301 GTGGATTTATTTATCAAAACAGG - Intronic
949202908 3:1401626-1401648 TTGGATGCATATGGAAACACTGG + Intronic
949558494 3:5181026-5181048 TTGGTTTGATTTGTAAAAACTGG - Intergenic
949686513 3:6578224-6578246 TTCAATTTATTTGGAGAATCCGG + Intergenic
950079592 3:10211653-10211675 TAGGATTTATTTAACAAAACTGG - Intronic
950757097 3:15184047-15184069 TTGTATTTTTTTGTAGAAACCGG - Intergenic
951316751 3:21196574-21196596 TTGAAGTAATTTGGAAACACTGG - Intergenic
952353496 3:32563233-32563255 TTTGCTTTATTTGTAAAATCAGG - Intronic
952600612 3:35077316-35077338 TTGGATATATATTCAAAAACAGG - Intergenic
952636996 3:35544942-35544964 TTGAATTTATTGGGTAAAAAAGG + Intergenic
952713071 3:36451387-36451409 CTGGATTAATCTGCAAAAACAGG - Intronic
953687342 3:45088308-45088330 TTGTATTTTTTTGTAGAAACGGG - Intronic
954174438 3:48832930-48832952 TTGGATGTATTTGCACAATCTGG - Intronic
954968651 3:54633488-54633510 TCGGATTTATTGGGCAAAAAGGG + Intronic
955029963 3:55206405-55206427 TTGGCTTTATAAGGAAATACAGG + Intergenic
955327519 3:58020750-58020772 TTGGAGTTATTTGGAACACAGGG + Intronic
955833799 3:63031689-63031711 TTGTATTTTTTTGGAAAGATGGG - Intergenic
956147904 3:66210683-66210705 TTGTATTTATTTGTAAAGATGGG + Intronic
957790870 3:84939837-84939859 TTGGGTTTACTTGCAAAAGCAGG - Intergenic
958954535 3:100452945-100452967 TTTGTTTTATTTTGCAAAACAGG + Intronic
959142320 3:102501208-102501230 TTTCATTCATTTAGAAAAACAGG - Intergenic
959282778 3:104366744-104366766 TTTGATTTATTTAGAAAAAAAGG + Intergenic
959571015 3:107884021-107884043 TTTGAATTATTTGGGAGAACTGG - Intergenic
960870651 3:122246544-122246566 CTGGTTTTCTTTGGAAAACCTGG - Intronic
960977169 3:123186587-123186609 TTGTATTTTTTTGCAAAGACGGG + Intronic
961667433 3:128502304-128502326 TTAAATTTATATGGAAAAAATGG - Intergenic
962094094 3:132275995-132276017 TTGGATTTACTTGGCAATGCAGG + Intronic
963257671 3:143161897-143161919 CTGGACTTATTTTGAAAAATTGG - Intergenic
964935151 3:162075456-162075478 TTGGTTCTGTTTGGAAAAGCAGG - Intergenic
965481054 3:169220153-169220175 TTGTATTTTTTTGGAGAGACAGG - Intronic
965556585 3:170024752-170024774 TTGGTTTGGTTTGGAAAAGCAGG - Intergenic
966357733 3:179099820-179099842 TTGTATTTTTTTGTAAAGACGGG - Intergenic
966416206 3:179692494-179692516 TTGGGTTTAGTTGGTTAAACTGG - Intronic
966825419 3:183960956-183960978 TTGTATTTTTTTGTAAAGACGGG + Intronic
967534192 3:190583820-190583842 TTGGCTTTACTTGTAACAACCGG - Intronic
968263772 3:197346284-197346306 TTGTATTTTTTTGTAGAAACGGG + Intergenic
969168292 4:5337158-5337180 TTGTATTTTTTTGTAAAAACAGG + Intronic
969297164 4:6277013-6277035 GTGCCCTTATTTGGAAAAACAGG - Intronic
969961623 4:10950223-10950245 CTGGATTTATTTAGAAAAACTGG + Intergenic
969991449 4:11267972-11267994 TTGTATATATTTGTAAAACCTGG - Intergenic
970928011 4:21475471-21475493 TTGCTTTTATTTGGAAAAGTCGG - Intronic
971411263 4:26375129-26375151 TTGTATTTTTTTGCAGAAACAGG - Intronic
971998297 4:33995284-33995306 TGGGATTTATTGGGAAAAAAGGG - Intergenic
972512127 4:39777580-39777602 TTTGTTTTATTTGGAAAAGTAGG + Intronic
973365060 4:49202185-49202207 TAAGATTTATTTTGAAAAAGAGG + Intergenic
973369289 4:49232562-49232584 TATGATTTATTTTGAAAAATAGG + Intergenic
973391748 4:49562854-49562876 TATGATTTATTTTGAAAAATAGG - Intergenic
973395532 4:49590269-49590291 TAAGATTTATTTTGAAAAAGAGG - Intergenic
974664504 4:64940289-64940311 TTGTATTTTTTTGTAGAAACGGG + Intergenic
974929017 4:68339407-68339429 TTGGACATAATTGGAAAAACTGG + Intronic
975102647 4:70531825-70531847 TTTGTATTATTTGTAAAAACGGG + Intronic
975425980 4:74228102-74228124 ATGTAATTTTTTGGAAAAACAGG - Intronic
976188065 4:82462749-82462771 TTGGAGTAGTTTGGAAAAAATGG + Intergenic
976408333 4:84684521-84684543 TTGGATTCATTTTGTAAAAGTGG - Intronic
976439410 4:85056094-85056116 TTGGATTTATTGGTAATCACAGG - Intergenic
976570508 4:86602868-86602890 TTGTATTTATTTGTAGAAATGGG + Intronic
976795650 4:88929908-88929930 TTGAATTTTTTTGTAAAGACAGG + Intronic
977170912 4:93761422-93761444 TGGGCTTTATTTGTAAAAACAGG - Intronic
977400961 4:96531634-96531656 TTGGAATTATGTGGAACAAAGGG + Intergenic
977720387 4:100233007-100233029 TTGGCTTGCTTAGGAAAAACCGG - Intergenic
978339691 4:107709223-107709245 TTTGATTTACTTTGAAAAATTGG - Intronic
978482084 4:109204423-109204445 TAGGAATAATTTGGAAAAAATGG + Intronic
978532078 4:109725456-109725478 TTTGCTTTATTTGTAAAAACTGG - Intronic
978589752 4:110312322-110312344 TTGTATTTTTTTGTAAAGACAGG - Intergenic
978835928 4:113149701-113149723 TTGTATTTTTTTGTAGAAACAGG - Intronic
979577449 4:122311097-122311119 TAGAATATATTTGGAAAAAAAGG + Intronic
979654968 4:123181438-123181460 TTGTATTTTTTTGTAGAAACAGG - Intronic
979803932 4:124947044-124947066 TTGGATTTTTTTGTAGAGACAGG + Intergenic
980198982 4:129629724-129629746 TTGTCTTAATTTGGATAAACAGG + Intergenic
981179137 4:141717830-141717852 TTGTATTTTTTTGTAAAGACGGG + Intronic
981377865 4:144036791-144036813 TGGGTTTGATTTGGGAAAACTGG - Intergenic
981601398 4:146492541-146492563 TTGTATTTTTTTGGAAAGATGGG + Intronic
981993206 4:150949091-150949113 TTTTATTTATTTGGGAAAAATGG - Intronic
982973485 4:162021916-162021938 TTGTATTTTTTAGGAGAAACGGG - Intronic
983515209 4:168648516-168648538 TCGGATTTATTAGGACTAACTGG - Intronic
983721890 4:170865501-170865523 TAGTATTTATTTCTAAAAACAGG + Intergenic
983799619 4:171910463-171910485 TTGGAATTATTTGTAAAATTTGG + Intronic
983823148 4:172222380-172222402 TGGGATTTATTTGCAAGAAAAGG - Intronic
984644266 4:182203042-182203064 TTGGATTTTTTTGTAGAGACAGG - Intronic
985323595 4:188741759-188741781 TTGGATTTATTGCTAAAACCTGG + Intergenic
1202762441 4_GL000008v2_random:123812-123834 TAAGATTTATTTTGAAAAAGAGG + Intergenic
1202766387 4_GL000008v2_random:151987-152009 TATGATTTATTTTGAAAAAGAGG + Intergenic
986514750 5:8549419-8549441 TTGGATTGATTCTGAAATACTGG - Intergenic
986610290 5:9560319-9560341 TTCACTTTATTTAGAAAAACAGG + Intergenic
986674925 5:10175703-10175725 TTAGTTTTCTTAGGAAAAACTGG - Intergenic
986886831 5:12248490-12248512 TTGAAATTATTTGGAAATATTGG - Intergenic
986891370 5:12311763-12311785 TTGGGTTTATTTGCCAAAAAGGG + Intergenic
987043031 5:14080583-14080605 TTGTATTTTTTTGTAGAAACGGG + Intergenic
987098756 5:14573992-14574014 TTGGCTTTATTTTTAAAAATGGG + Intergenic
987361207 5:17108214-17108236 TTGTATTTTTTTGTAAAGACAGG + Intronic
987493602 5:18614532-18614554 TTTGATTTATACGCAAAAACTGG - Intergenic
987604654 5:20116855-20116877 ATGGATTTTTCTGGAAAAATTGG - Intronic
987910908 5:24144071-24144093 TTGTTTTTCTTTGGTAAAACAGG + Intronic
988014765 5:25540287-25540309 TTGTATTTACATGGAAAAGCAGG - Intergenic
988330584 5:29834017-29834039 TTGGAGTTATTTGAAATAAAAGG + Intergenic
988582239 5:32478299-32478321 TTGTATTTCTTTGTAGAAACAGG - Intergenic
988972484 5:36483626-36483648 TTGGCTTTATCTGGAGAAGCAGG - Intergenic
989243051 5:39221823-39221845 TTGGATTTTTTAGTAGAAACAGG - Intronic
989432226 5:41369372-41369394 CTAGCTTTATTTTGAAAAACAGG + Intronic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
990430146 5:55726474-55726496 TTGTATTTTTTTGTAGAAACAGG - Intronic
990680418 5:58236817-58236839 TTGGATGTACTGGGAAAAGCTGG + Intergenic
991076233 5:62541506-62541528 TTGTATTTTTTTGTAAAGACGGG - Intronic
991470284 5:66961456-66961478 TTGGATTTATCAGTAAACACAGG + Intronic
991774444 5:70071264-70071286 TTGTATTTTTTTGTAAAGACAGG + Intronic
991853738 5:70946689-70946711 TTGTATTTTTTTGTAAAGACAGG + Intronic
992061515 5:73053237-73053259 ATGTATTTGTTTGGAAAAAAAGG + Intronic
992211678 5:74485945-74485967 TTGGTTATTTTTGGTAAAACTGG + Intergenic
992734157 5:79702223-79702245 TTAAATTTTTTTGTAAAAACAGG - Intronic
994007606 5:94857998-94858020 TTTGAATTACTTAGAAAAACTGG - Intronic
994413227 5:99436479-99436501 TTGTATTTTTTTGTAAAAATGGG + Intergenic
994489665 5:100424882-100424904 TAGGACTTGTTAGGAAAAACAGG + Intergenic
994566429 5:101451805-101451827 TTGGATTTGTTTGTCAAAAATGG + Intergenic
995858402 5:116617247-116617269 AAGTATTTATTTGTAAAAACAGG + Intergenic
995931267 5:117448703-117448725 TTTGATATATTTAGAAAAATGGG + Intergenic
996143170 5:119940082-119940104 TTGAAGTTATTTGAAAAACCTGG + Intergenic
996414360 5:123194172-123194194 TTGTATTTAAATGAAAAAACAGG + Exonic
996550984 5:124729776-124729798 TTAGGTTTAATTGTAAAAACTGG - Intronic
996599080 5:125240716-125240738 TTAGATATATGTTGAAAAACGGG - Intergenic
996709057 5:126525903-126525925 TTGAATTTATTAGGCAAAAAAGG - Intergenic
996767878 5:127053094-127053116 GTGGACTGATTAGGAAAAACAGG - Intronic
997006484 5:129822546-129822568 TTGGGGTAATTTGGACAAACTGG + Intergenic
997250667 5:132386401-132386423 TTGTATTTCTTTGGAGAGACGGG + Intronic
998968735 5:147568552-147568574 TTTAGTTTATTTGGAAAATCAGG + Intergenic
999177533 5:149641795-149641817 TTGTATTTTTTTGGAGAGACGGG - Intergenic
999295202 5:150455169-150455191 TTGGTTTTATTTTGAAAATGGGG + Intergenic
999879986 5:155851681-155851703 ATGTATGTATTTGGAAAAAGTGG - Intergenic
1000278120 5:159757396-159757418 TTGCATTTTTTTAGAAAAATAGG - Intergenic
1000938819 5:167335746-167335768 TTGGATTTGTTTGGATAAGATGG - Intronic
1001463683 5:171942626-171942648 TTGGATTTTTTTGTAGAGACGGG - Intronic
1001907853 5:175487838-175487860 AGGTATTTAGTTGGAAAAACTGG - Intronic
1002087231 5:176783761-176783783 TTGGATTTTTTTGTAAAGATGGG - Intergenic
1002491375 5:179580177-179580199 TTTGATTTGTTTACAAAAACGGG - Intronic
1003267070 6:4575279-4575301 CTGTATTTTTTTGGAAAGACAGG - Intergenic
1003725839 6:8762548-8762570 ATAGATTTATTTGCAAAAATGGG - Intergenic
1003788264 6:9512702-9512724 TAGGATTGACTTGGCAAAACTGG + Intergenic
1003935880 6:10974882-10974904 TTGAATTTATTTTGGAAAAATGG + Intronic
1004356878 6:14937362-14937384 TTTGAGTTCTTTGTAAAAACTGG + Intergenic
1004380644 6:15129388-15129410 TTGTATTTTTTTGTAAAGACGGG - Intergenic
1004713769 6:18197035-18197057 TTGGTTTTATTTCCAAACACAGG + Exonic
1004915739 6:20330332-20330354 TTGTATTTATTTGTAGAGACAGG - Intergenic
1005248390 6:23915202-23915224 TTGGATTGATATGGAATAAAGGG + Intergenic
1007941325 6:45784228-45784250 TTGTATGTATTTGAAAGAACAGG + Intergenic
1008157009 6:48028112-48028134 TTGTATTTTTTTGTAAAGACAGG + Intronic
1008496346 6:52137827-52137849 ATGTATTTATTTGGAAAACTAGG + Intergenic
1008856529 6:56094957-56094979 ATGGTTTTATTTGGATAAAAAGG - Intronic
1010219068 6:73431999-73432021 TTGGATTTTTTTGTAGAGACGGG + Intronic
1010373669 6:75141043-75141065 ATGGATATATTTGGATATACTGG + Intronic
1010720473 6:79277682-79277704 TTGTATTTTTTTGTAGAAACAGG - Intergenic
1011678817 6:89762881-89762903 TTGTATTTTTTTGTAGAAACAGG - Intronic
1011840564 6:91493046-91493068 TTGTATTTTTTTGTAGAAACGGG - Intergenic
1012041076 6:94204718-94204740 GTGGATATATTTGCAAAAAAAGG - Intergenic
1012229738 6:96746845-96746867 TTCTATTTATCTGGAGAAACTGG + Intergenic
1012338774 6:98092188-98092210 TTGTATTTTTTTGTAAAGACAGG - Intergenic
1012635580 6:101535484-101535506 TTGGCTTTGTTTGGGAAATCGGG + Intronic
1012714085 6:102647427-102647449 TTGGATTTATTTGGCCATTCAGG - Intergenic
1013457234 6:110341336-110341358 TTGAATTTATTTGGATATCCTGG - Intronic
1013773299 6:113650958-113650980 AGAGATTTATTAGGAAAAACGGG - Intergenic
1013784387 6:113763722-113763744 TTGCACTTAGTTGGAAAAACAGG - Intergenic
1014017254 6:116547388-116547410 TTGGATGTATTAGAAAAAGCCGG + Intronic
1014920038 6:127203097-127203119 TTGGATTTAATTGGATCATCTGG - Intergenic
1015079869 6:129210731-129210753 TAGGATTTTGTTTGAAAAACAGG - Intronic
1016098413 6:140066758-140066780 TTGGATTCTTTTTGAAATACAGG - Intergenic
1016325494 6:142896604-142896626 ATTTATTTATCTGGAAAAACTGG - Intronic
1017185399 6:151595642-151595664 TTGTATTTTTTTGTAAAGACAGG - Intronic
1017312258 6:152987609-152987631 TTGGATTTATTGCTAAAACCTGG - Exonic
1017856216 6:158351425-158351447 TTTGATTAATTTGCAAAAACGGG - Intronic
1019083330 6:169451301-169451323 TTGGTTCTATCTGGAAAGACAGG - Intergenic
1019396369 7:821581-821603 TTGGATTTATTTTCAGAATCTGG - Intronic
1019619502 7:1983859-1983881 TTGGTTTTATTTCAAATAACAGG + Intronic
1020258374 7:6515603-6515625 TTGTATTTTTTTGTAGAAACAGG - Intronic
1020516257 7:9123873-9123895 TTGGTTTAATTTGAAAAAAATGG - Intergenic
1020821957 7:12981263-12981285 TTAGATTTAGTTTGAATAACTGG - Intergenic
1021035725 7:15795708-15795730 CTTGATTTATGTGGAATAACTGG + Intergenic
1021329970 7:19324283-19324305 TTGGATAGGGTTGGAAAAACAGG + Intergenic
1021725721 7:23546496-23546518 TCATATTTATTTGAAAAAACAGG + Intergenic
1021925118 7:25526810-25526832 TTGTATTTTTTTGTAAAGACAGG + Intergenic
1022099958 7:27163574-27163596 TTGGGCTTATTTAGAAAAAAGGG - Exonic
1022322365 7:29299023-29299045 TTGAATTTATTGGGAAAAAAGGG + Intronic
1022731712 7:33032626-33032648 TTGCATTTTTTTGTAGAAACAGG + Intronic
1023012961 7:35939787-35939809 TTGTATTTTTTTGTAGAAACGGG + Intergenic
1023115610 7:36859040-36859062 ATTTATTTATTGGGAAAAACAGG - Intronic
1023267396 7:38421539-38421561 TTTGATATATTTGCAAAGACAGG - Intronic
1023486283 7:40690747-40690769 TTGTATTTTTTTGTAGAAACGGG + Intronic
1023581094 7:41683484-41683506 TTGGATTAATGTAGAAACACTGG + Intergenic
1023661397 7:42474739-42474761 TTGGATGTATTTGGAAGATCAGG + Intergenic
1023917117 7:44597723-44597745 TTGTATTTTTTTGGAAAGATGGG + Intergenic
1024112605 7:46162392-46162414 TGGGATTTATTGGGCAAAAAGGG + Intergenic
1024385049 7:48741443-48741465 TTTGCTTTATTTGGAATAGCTGG + Intergenic
1024809392 7:53189743-53189765 TTGCCTCTATTTAGAAAAACAGG + Intergenic
1026158303 7:67846884-67846906 TTGTATTTTTTTGTAGAAACAGG + Intergenic
1026319295 7:69254987-69255009 TTGGATATATTTGGAGCAAAAGG + Intergenic
1028179417 7:87700596-87700618 TTGCATGTATTTGGAATAGCAGG + Intronic
1028235897 7:88361281-88361303 TGGGATTTATTGGGCAAAAAGGG + Intergenic
1028687438 7:93607162-93607184 ATGTATTTGTTTGGAATAACTGG + Intronic
1028914329 7:96242287-96242309 TTGGATAAATTTGGATAAACTGG - Intronic
1029309042 7:99644210-99644232 ATGGGGTTATTTGGATAAACAGG + Intergenic
1030036507 7:105411813-105411835 TTTCATTTTTTTTGAAAAACGGG + Intergenic
1031142277 7:117956517-117956539 GTGGACTTATTTGGAAAAAATGG - Intergenic
1031562924 7:123260255-123260277 TTGGATTACTGTAGAAAAACAGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032260142 7:130329112-130329134 TTGTATTTTTTTGTAGAAACGGG - Intergenic
1033156412 7:138960835-138960857 TTTGATCTCTTTGGAAAATCCGG - Intronic
1033503289 7:141975628-141975650 TTGGATTGATTTTTAAAAATTGG + Intronic
1033505758 7:141998058-141998080 CTAAATTAATTTGGAAAAACTGG - Intronic
1033803822 7:144931753-144931775 TTGTAATTATTTGAAAAAACAGG - Intergenic
1033905379 7:146195228-146195250 TTGATTTTCTTTGGAAAAAACGG + Intronic
1034060074 7:148079270-148079292 TTGGTTTTGTCTGGAAAAGCAGG + Intronic
1034550406 7:151816858-151816880 TTGGTTTTCCTTGGAAAAGCTGG + Intronic
1034561457 7:151882125-151882147 TTTTATTTATATGGAATAACAGG - Intergenic
1034865311 7:154636669-154636691 TTGGAGTTATTTGGAGGAACAGG - Intronic
1036141665 8:6214823-6214845 AGGGATTTATTAGGAAAAACTGG - Intergenic
1036492215 8:9238199-9238221 TTAGATTTTTTTAAAAAAACTGG - Intergenic
1036660830 8:10707400-10707422 TTGCATTTTTTTGTAAATACAGG + Intronic
1037580418 8:20242446-20242468 TTGTATTTTTTTGTAGAAACGGG - Intergenic
1037692432 8:21193535-21193557 CTGGATTTAATTGGAAAAGAAGG + Intergenic
1037906954 8:22721173-22721195 CTGCATTTATTTGGCAGAACAGG + Intronic
1038674535 8:29611775-29611797 TGAGATCTAGTTGGAAAAACAGG - Intergenic
1038755213 8:30334237-30334259 TTTGATTTTTTTGTAAAGACAGG - Intergenic
1039458152 8:37721654-37721676 TTGGATTTTTTTGTAGAAACTGG + Intergenic
1039520559 8:38167513-38167535 TTGTATTTTTTTGTAAAGACAGG + Intronic
1039891896 8:41691218-41691240 TTGGTTTTATTTTTAGAAACAGG - Intronic
1040578896 8:48678957-48678979 TAGGAGTTATATGTAAAAACTGG + Intergenic
1041171121 8:55142678-55142700 CTGGATTTATTTACCAAAACTGG - Intronic
1041927253 8:63249663-63249685 TTTAATTTAAGTGGAAAAACAGG - Intergenic
1042109954 8:65370441-65370463 TTGTATTTTTTTGTAAAGACAGG - Intergenic
1042494067 8:69436265-69436287 TTGGATTTTTTAGTAGAAACAGG - Intergenic
1042658310 8:71125925-71125947 TTGTATTTTTTTGTAGAAACAGG + Intergenic
1043043684 8:75294224-75294246 TTGGATCAAGATGGAAAAACAGG + Intergenic
1043485603 8:80696342-80696364 TTGGAATTATTTAAAAATACAGG + Intronic
1044379342 8:91515673-91515695 TTTAATTTATTTTGAAAACCTGG - Intergenic
1046007046 8:108499719-108499741 TTGTATTTTTTTGTAGAAACGGG + Intergenic
1046401978 8:113716190-113716212 TTGAATTTTTTTTAAAAAACAGG - Intergenic
1046596351 8:116265629-116265651 TAAGCTTTATTTGCAAAAACAGG + Intergenic
1046910558 8:119621738-119621760 TTGGGTTCCTTTGGAAAAATGGG + Intronic
1047525649 8:125632110-125632132 TTGTATTTTTTTGTAAAGACGGG - Intergenic
1047707689 8:127517156-127517178 TTGGATTTATTTGAAAAATTTGG - Intergenic
1049092707 8:140528750-140528772 TTGGATAAATTTTGTAAAACTGG - Intergenic
1049530228 8:143150874-143150896 TTGGATTCTTTTAAAAAAACAGG - Intergenic
1050452757 9:5800903-5800925 CTGCATCTATTTGGAAAAACAGG - Intronic
1050730163 9:8700582-8700604 TTTCATTCATTTGTAAAAACAGG + Intronic
1050853629 9:10322019-10322041 TTGAATTTATTTTGAAATCCTGG - Intronic
1051084066 9:13327345-13327367 TTGTATTTTTTTGTAAAGACAGG - Intergenic
1052103327 9:24478706-24478728 TTGGATCCACTTGGATAAACTGG - Intergenic
1052137823 9:24937219-24937241 TTGTATTTTTTTGTAAAGACAGG - Intergenic
1052552965 9:29974944-29974966 TTTTATTTATTTTGAAAATCAGG + Intergenic
1052750514 9:32484975-32484997 TTGGATTTAAAAGGAAAAAAAGG + Intronic
1053662615 9:40294661-40294683 TTTGATTCATTTTGAAAAAGAGG - Intronic
1053913063 9:42924838-42924860 TTTGATTCATTTTGAAAAAGAGG - Intergenic
1054374745 9:64440886-64440908 TTTGATTCATTTTGAAAAAGAGG - Intergenic
1054521996 9:66081623-66081645 TTTGATTCATTTTGAAAAAGAGG + Intergenic
1055245395 9:74235474-74235496 TTGGATTAATTGGGTAAAAGTGG + Intergenic
1055352574 9:75404295-75404317 TTAGATTTATTTAGAATATCTGG - Intergenic
1055606562 9:77976783-77976805 TTTTATTTACCTGGAAAAACTGG + Intronic
1056039939 9:82654648-82654670 TTGCATTTATTTTAAAAATCTGG + Intergenic
1056125127 9:83528697-83528719 TTGTATTTTTTTGTAAACACAGG + Intronic
1056128261 9:83558471-83558493 TTGACTTTATTTGTAAATACAGG + Intergenic
1056674608 9:88664577-88664599 TGGGATTTGTTGGGAAAGACTGG - Intergenic
1057086236 9:92213451-92213473 TTCACTTTATTTGGAAAAAGAGG + Intronic
1057102875 9:92379990-92380012 TTGCAATTATTTGGAATAACTGG + Intronic
1057383403 9:94588448-94588470 TTGTATTTTTTTGTAAAGACAGG - Intronic
1057481802 9:95450544-95450566 TTGGAGCTATTTGGTAAAACTGG - Intronic
1058870950 9:109201276-109201298 TTGTATTTTTTTGTAGAAACGGG - Intronic
1059664809 9:116436686-116436708 TAAGATTTATTTAGAAAAAAAGG + Intronic
1060075315 9:120585448-120585470 TTGGAGTTAATTTGACAAACTGG - Intergenic
1061592466 9:131606794-131606816 TTTGATTTTTTTGTAGAAACGGG + Intronic
1061813551 9:133178850-133178872 TTGCCTTTACTTGGAAAAATAGG - Intergenic
1203749410 Un_GL000218v1:64769-64791 TAAGATTTATTTTGAAAAAGAGG - Intergenic
1203543205 Un_KI270743v1:108693-108715 TAAGATTTATTTTGAAAAAGAGG + Intergenic
1203547142 Un_KI270743v1:136877-136899 TATGATTTATTTTGAAAAAGAGG + Intergenic
1185491033 X:517138-517160 TTGGTTTGGTTTGGAAAAGCAGG + Intergenic
1185825824 X:3248705-3248727 TTGTATTTTTTTGTAGAAACAGG + Intergenic
1187455985 X:19441627-19441649 TTGTATTTTTTTGTAAAGACAGG + Intronic
1187462908 X:19503596-19503618 TTGTATTTTTTGGGAAAGACAGG + Intronic
1187577028 X:20567985-20568007 TTGGATTTGTTTAAAAAAAAGGG + Intergenic
1188434064 X:30140134-30140156 TTGGATTTACTTAGGAAAAAAGG - Intergenic
1188762850 X:34053884-34053906 TTGAATTTATTTGGCAAAAAGGG - Intergenic
1189739830 X:44106289-44106311 GTGACTTTATTTGGAAAAAAGGG + Intergenic
1189925145 X:45945690-45945712 TTAGCTTTATTTTTAAAAACTGG + Intergenic
1190592068 X:52013306-52013328 TAGGATGTGTTTGGAAAAAGGGG + Intergenic
1190764376 X:53463961-53463983 TTGTATTTTTTTGTAGAAACAGG + Intergenic
1190794693 X:53730163-53730185 CTGGATTTATTTGAAATGACAGG - Intergenic
1191221571 X:57993852-57993874 TTGAATTTATTTGGGTAAAAGGG + Intergenic
1191656502 X:63604609-63604631 TTGAATTTATTTCAAAAAATTGG - Intergenic
1192038832 X:67595631-67595653 TTGTATATTTTTGGAAAGACAGG - Intronic
1192444624 X:71201541-71201563 TTGGAGCCATTTGGAAAAAGAGG + Intergenic
1192781082 X:74294089-74294111 TTGTATTTATTTGTAGAGACGGG - Intergenic
1193025208 X:76839353-76839375 TTGAATTTATTTCAAAAAAGTGG + Intergenic
1194295009 X:92116757-92116779 TTGTATTTTTTTGTAGAAACAGG + Intronic
1194809637 X:98374898-98374920 ATGGATTTATTGGGCAAAAAGGG + Intergenic
1195017548 X:100794132-100794154 TTGTCTTTATTTGGAAAGAATGG + Intergenic
1195054569 X:101131180-101131202 TTGTATTTTTTTGTAAAAACGGG + Intronic
1195431541 X:104795044-104795066 GTAGGTTTATTTGGAAAGACTGG - Intronic
1195498677 X:105568335-105568357 ATGGATTTATTTTAAAAATCAGG + Intronic
1196520506 X:116665528-116665550 TAGGATGCAATTGGAAAAACTGG - Intergenic
1196685508 X:118506911-118506933 TTTTATTTTTTTGGAAAGACGGG - Intronic
1196838248 X:119833231-119833253 TTTGATTTCTTTGGAAATAAAGG - Intergenic
1196886160 X:120247762-120247784 TTGGGTTTTTATGGAAAACCAGG + Intergenic
1197031836 X:121825726-121825748 TTGGATTTCTTTGGCTAATCAGG - Intergenic
1197348711 X:125356906-125356928 TGGAATTTATTTGGTAAAAAGGG - Intergenic
1197791506 X:130258597-130258619 TTTGAGGTATTTGGAAAAAAGGG - Intronic
1197836444 X:130699013-130699035 TTGGATTCATCTGGAATGACTGG + Intronic
1198156416 X:133965224-133965246 GTGACCTTATTTGGAAAAACGGG + Intronic
1198666393 X:139028306-139028328 TTGGATTTGATGGGAAAATCTGG + Intronic
1199621934 X:149709413-149709435 TTCTAATTATTTGGTAAAACTGG - Intronic
1199748996 X:150796645-150796667 TGGGATTTAATTGGCACAACAGG + Intronic
1200612507 Y:5341277-5341299 TTGTATTTTTTTGTAGAAACAGG + Intronic
1201162774 Y:11179780-11179802 TAAGATTTATTTTGAAAAAGAGG - Intergenic
1201334815 Y:12869388-12869410 TGTGATTTATTATGAAAAACAGG - Intergenic
1201609978 Y:15830408-15830430 TTGCATTTTTTTGTAAAGACGGG + Intergenic
1202039935 Y:20671458-20671480 TGAGATTTTTTTGAAAAAACAGG - Intergenic
1202274259 Y:23099349-23099371 TTGGATTAATTTAGATTAACTGG - Intergenic
1202291767 Y:23321328-23321350 TTGGATTAATTTAGATTAACTGG + Intergenic
1202427254 Y:24733094-24733116 TTGGATTAATTTAGATTAACTGG - Intergenic
1202443537 Y:24937000-24937022 TTGGATTAATTTAGATTAACTGG + Intergenic