ID: 924088787

View in Genome Browser
Species Human (GRCh38)
Location 1:240481646-240481668
Sequence GTTTCATCGGGGGAAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924088778_924088787 19 Left 924088778 1:240481604-240481626 CCAAAACATTTAATGCAATCCAA No data
Right 924088787 1:240481646-240481668 GTTTCATCGGGGGAAGAGGGAGG No data
924088779_924088787 0 Left 924088779 1:240481623-240481645 CCAAATAAAAATACCTGCAGAAT No data
Right 924088787 1:240481646-240481668 GTTTCATCGGGGGAAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924088787 Original CRISPR GTTTCATCGGGGGAAGAGGG AGG Intergenic
No off target data available for this crispr