ID: 924089217

View in Genome Browser
Species Human (GRCh38)
Location 1:240485583-240485605
Sequence GTGTGTTAGGGGTAGGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924089217_924089228 25 Left 924089217 1:240485583-240485605 CCCCACACCTACCCCTAACACAC No data
Right 924089228 1:240485631-240485653 CTCCCCAGATACCGTCTTCAGGG No data
924089217_924089227 24 Left 924089217 1:240485583-240485605 CCCCACACCTACCCCTAACACAC No data
Right 924089227 1:240485630-240485652 TCTCCCCAGATACCGTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924089217 Original CRISPR GTGTGTTAGGGGTAGGTGTG GGG (reversed) Intergenic
No off target data available for this crispr