ID: 924093334 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:240524962-240524984 |
| Sequence | GGTCACGGTGTCTCAGTAGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 54 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 52} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 924093334_924093340 | 28 | Left | 924093334 | 1:240524962-240524984 | CCAGCTACTGAGACACCGTGACC | 0: 1 1: 0 2: 0 3: 1 4: 52 |
||
| Right | 924093340 | 1:240525013-240525035 | CTTAGTTTTCTCTACTTCCTCGG | 0: 1 1: 0 2: 6 3: 103 4: 480 |
||||
| 924093334_924093341 | 29 | Left | 924093334 | 1:240524962-240524984 | CCAGCTACTGAGACACCGTGACC | 0: 1 1: 0 2: 0 3: 1 4: 52 |
||
| Right | 924093341 | 1:240525014-240525036 | TTAGTTTTCTCTACTTCCTCGGG | 0: 1 1: 3 2: 293 3: 522 4: 807 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 924093334 | Original CRISPR | GGTCACGGTGTCTCAGTAGC TGG (reversed) | Intronic | ||