ID: 924093334

View in Genome Browser
Species Human (GRCh38)
Location 1:240524962-240524984
Sequence GGTCACGGTGTCTCAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924093334_924093340 28 Left 924093334 1:240524962-240524984 CCAGCTACTGAGACACCGTGACC 0: 1
1: 0
2: 0
3: 1
4: 52
Right 924093340 1:240525013-240525035 CTTAGTTTTCTCTACTTCCTCGG 0: 1
1: 0
2: 6
3: 103
4: 480
924093334_924093341 29 Left 924093334 1:240524962-240524984 CCAGCTACTGAGACACCGTGACC 0: 1
1: 0
2: 0
3: 1
4: 52
Right 924093341 1:240525014-240525036 TTAGTTTTCTCTACTTCCTCGGG 0: 1
1: 3
2: 293
3: 522
4: 807

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924093334 Original CRISPR GGTCACGGTGTCTCAGTAGC TGG (reversed) Intronic