ID: 924099371

View in Genome Browser
Species Human (GRCh38)
Location 1:240587968-240587990
Sequence CAGTTTTCCATCAAAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 209}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924099371_924099377 20 Left 924099371 1:240587968-240587990 CCTTGCTCTTTGATGGAAAACTG 0: 1
1: 0
2: 2
3: 19
4: 209
Right 924099377 1:240588011-240588033 CCCACGGTGCCTGCAGGCACAGG 0: 1
1: 0
2: 0
3: 23
4: 281
924099371_924099373 -5 Left 924099371 1:240587968-240587990 CCTTGCTCTTTGATGGAAAACTG 0: 1
1: 0
2: 2
3: 19
4: 209
Right 924099373 1:240587986-240588008 AACTGCTGTGAAACGGCACATGG 0: 1
1: 0
2: 0
3: 5
4: 91
924099371_924099374 4 Left 924099371 1:240587968-240587990 CCTTGCTCTTTGATGGAAAACTG 0: 1
1: 0
2: 2
3: 19
4: 209
Right 924099374 1:240587995-240588017 GAAACGGCACATGGAACCCACGG 0: 1
1: 0
2: 0
3: 7
4: 97
924099371_924099380 27 Left 924099371 1:240587968-240587990 CCTTGCTCTTTGATGGAAAACTG 0: 1
1: 0
2: 2
3: 19
4: 209
Right 924099380 1:240588018-240588040 TGCCTGCAGGCACAGGGAGCTGG 0: 1
1: 0
2: 7
3: 164
4: 1127
924099371_924099379 21 Left 924099371 1:240587968-240587990 CCTTGCTCTTTGATGGAAAACTG 0: 1
1: 0
2: 2
3: 19
4: 209
Right 924099379 1:240588012-240588034 CCACGGTGCCTGCAGGCACAGGG 0: 1
1: 0
2: 4
3: 17
4: 234
924099371_924099375 14 Left 924099371 1:240587968-240587990 CCTTGCTCTTTGATGGAAAACTG 0: 1
1: 0
2: 2
3: 19
4: 209
Right 924099375 1:240588005-240588027 ATGGAACCCACGGTGCCTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924099371 Original CRISPR CAGTTTTCCATCAAAGAGCA AGG (reversed) Intronic
901014851 1:6222825-6222847 AACTTTTCCCTCAAAGAGCCGGG + Exonic
902694661 1:18132376-18132398 CAGATTCCCATCACTGAGCATGG + Intronic
903150202 1:21402202-21402224 GAGTTTTCCATGAAAGGGGAAGG - Intergenic
903768117 1:25747632-25747654 CAGCTTGCCAGCACAGAGCAGGG + Intronic
906556049 1:46715127-46715149 CAGTTTTCAAGCTTAGAGCAAGG - Intronic
906804783 1:48770171-48770193 CAGTTTTGCACCACAGAGGAAGG - Intronic
908915668 1:69122909-69122931 CAGTTTTCAATCAAAGATGGAGG - Intergenic
908953007 1:69585041-69585063 CAGTTTACAATCAATGAACATGG - Intronic
909492210 1:76238244-76238266 TAGCTTTGCTTCAAAGAGCACGG - Intronic
909554710 1:76940771-76940793 CAGCTTGCCATGAAAGAGAAAGG - Intronic
909797424 1:79758828-79758850 CAGTTTTCCATCACAGTTGATGG - Intergenic
910691400 1:89969056-89969078 CTGTTGTCCATCCAAGAGCATGG + Intergenic
911453980 1:98100069-98100091 CTGGTATTCATCAAAGAGCAAGG - Intergenic
913479213 1:119269692-119269714 CTGTTTTCCATCAAAGGGTGAGG - Intergenic
915105080 1:153529234-153529256 CAGTGTTCCATAACACAGCAAGG + Intergenic
915797651 1:158753515-158753537 CAGTTTGCCGTGAAACAGCAGGG - Intergenic
916740882 1:167646130-167646152 GTGTTTTCCATCTAGGAGCATGG + Intronic
917433780 1:174999162-174999184 CTGTTTACCATCAAAGAAAATGG - Intronic
918322389 1:183376760-183376782 CTGTTTTCCATTAAATATCATGG + Intronic
918686095 1:187417795-187417817 AAGTTATACATCAAAGAGTATGG + Intergenic
923551071 1:234963825-234963847 CAGTATTCCTTCACAGAGCCAGG + Intergenic
924099371 1:240587968-240587990 CAGTTTTCCATCAAAGAGCAAGG - Intronic
1063687753 10:8254815-8254837 CAGAATTCCATGAAAGAGCCAGG + Intergenic
1063931465 10:11032536-11032558 TAGTTTTCCATCCAAAACCAAGG - Intronic
1064128803 10:12689252-12689274 CAGCTTTGCTTGAAAGAGCAGGG - Intronic
1065142218 10:22728825-22728847 CAGTTGTCCAACTTAGAGCATGG + Intergenic
1066411914 10:35179725-35179747 CAGTTTTTCCTAAAAGAGAATGG + Intronic
1066698567 10:38101149-38101171 AAATTTTGCATCAAAGGGCATGG - Intronic
1067665509 10:48274609-48274631 CAACTTTCCAACAAGGAGCAGGG + Exonic
1067698150 10:48550146-48550168 CACTTAACCTTCAAAGAGCAGGG + Intronic
1068053841 10:51985100-51985122 AACTTTTCCTTCATAGAGCATGG + Intronic
1068670227 10:59715067-59715089 CACTTTTCCATCAAAGTACTTGG + Intronic
1071603296 10:86969357-86969379 CACTTTTCCATCTGAGAGCTGGG + Intronic
1077002784 11:332935-332957 CAGTATTCAACCAAGGAGCAGGG - Intergenic
1077895811 11:6452465-6452487 CAGATTTGAATCCAAGAGCAAGG - Intronic
1078918064 11:15799473-15799495 CAGTTATCTTTCAAAGAGCTGGG + Intergenic
1080308243 11:30860016-30860038 CAGTTTTCCCTAGAAGAGAATGG - Intronic
1080748125 11:35127237-35127259 AAGTTTTCCATCCATGAACAAGG + Intergenic
1081644691 11:44781530-44781552 CAGTTATCCATCATCCAGCAAGG - Intronic
1082127731 11:48453049-48453071 CAGTTTTCCTTCTAACAGCCAGG + Intergenic
1082249685 11:49964372-49964394 CAGTTTTCCTTCTAACAGCCAGG - Intergenic
1082561284 11:54623978-54624000 CAGTTTTCCTTCTAACAGCCAGG + Intergenic
1083232002 11:61327969-61327991 CATTTTCCCATCAATGAGTAGGG + Intronic
1086094224 11:83034388-83034410 CAGCTTTGCCCCAAAGAGCAGGG + Intronic
1087489756 11:98810044-98810066 TAGTTTTCCACCAAAGAGCAAGG - Intergenic
1088540923 11:110912724-110912746 CAGTTTGCCAACAAAGGCCAAGG - Intergenic
1088565584 11:111169098-111169120 CTGTTTTCACTCAAAGAGCAAGG - Intergenic
1089782936 11:120886798-120886820 CTGTTTTCTCACAAAGAGCAAGG + Intronic
1090040171 11:123283681-123283703 CACTTATCCATCTAAAAGCAGGG + Intergenic
1090407157 11:126483486-126483508 CAGTTCTGAATCAAACAGCAGGG - Intronic
1091382188 12:69020-69042 CAGTTTTCCCTCAATGCCCAAGG + Intronic
1091608848 12:1985511-1985533 CAGTTTTACCTCACAGAGCATGG + Intronic
1094091086 12:26650852-26650874 TAGTTGTTAATCAAAGAGCAGGG - Intronic
1094805824 12:34090229-34090251 CAGTCTTCCATCAAAGACCCAGG - Intergenic
1095073829 12:37892800-37892822 CAGTCTGAGATCAAAGAGCAAGG + Intergenic
1095124500 12:38460221-38460243 CACTCTTCCATCAAAGACCCAGG - Intergenic
1096832572 12:54325697-54325719 CAGTATTCCATCAAAGTTCTGGG + Intronic
1097019961 12:56013528-56013550 CAGTTTTGTATCAAAGATCTTGG - Intronic
1097462648 12:59881369-59881391 CAGTTTGACATTAAAGAGAATGG - Intergenic
1100093178 12:90997413-90997435 CATTTTTCCAGCAAAGTGCTTGG - Intronic
1103258707 12:119565629-119565651 CAGTTTGCCATCAATAAACAGGG - Intergenic
1105411474 13:20174902-20174924 CAGGTTTTCTTAAAAGAGCATGG - Intergenic
1110399426 13:75072544-75072566 CAGTTGTCAAGCAAACAGCATGG + Intergenic
1112941229 13:104864411-104864433 CAATTTTCCTTCTAAGAGGAAGG + Intergenic
1115759507 14:36564619-36564641 CAGAGATCCAACAAAGAGCATGG + Intergenic
1116673522 14:47874682-47874704 CTGTTTTCCATCAAGTAACATGG - Intergenic
1116997327 14:51337237-51337259 TTGTTTTCCATCCAAGAGCAAGG - Intergenic
1124027605 15:25981366-25981388 CACATTTCCAGCAAAGAGCATGG + Intergenic
1124953310 15:34343042-34343064 CAGTATTACCTCAACGAGCAGGG - Exonic
1128526942 15:68419001-68419023 TAGTTTGCATTCAAAGAGCAGGG - Intronic
1128810121 15:70564952-70564974 TAAATTTCCATCAAAGAACATGG - Intergenic
1129319219 15:74764654-74764676 CAGCTTCCCCTCACAGAGCACGG - Intergenic
1130892909 15:88148799-88148821 CAGTCTTCCAACCAAGAGAAGGG + Intronic
1132125980 15:99225098-99225120 CAGATTTCCAGCGAAGAGGACGG + Intronic
1136453642 16:30368875-30368897 GAGTTCCCCATCAAAGAGCAGGG + Intronic
1140233959 16:73141884-73141906 CAGATTTGCAACAAAGAGCAGGG + Intronic
1141716899 16:85732061-85732083 CAGTTGTCCTTAAAAGAGAAGGG + Intronic
1141909695 16:87050265-87050287 CACGTTTCCACCAAAGAGAATGG - Intergenic
1149739470 17:59031139-59031161 CATTTTTCAATCAAAGTCCAAGG - Intronic
1150971857 17:70037705-70037727 AAGTTTTCCATAAAAGAGAAAGG - Intergenic
1151149626 17:72073783-72073805 CAGTGGTCCATCACTGAGCATGG + Intergenic
1151588882 17:75030146-75030168 CAGTTTTACAAAAAAGAGAAGGG + Intergenic
1156240879 18:35252684-35252706 CGGGTTTCCATCAAAGTACATGG - Exonic
1156331292 18:36126314-36126336 CAGTGTCACATCAAAGAGCCGGG - Exonic
1158259361 18:55590080-55590102 CACTTTTGTGTCAAAGAGCAAGG - Intronic
1158782570 18:60668554-60668576 CCGTTTTCTCTTAAAGAGCATGG + Intergenic
1159031604 18:63237653-63237675 CAGCTTTCCATAAAATAACAAGG - Intronic
1160446886 18:78934913-78934935 CAGTTTTTCATCGAAGAGTCTGG - Intergenic
1161292568 19:3502998-3503020 CAGTTTTCCAACACATAGGAAGG - Intergenic
1165026179 19:32963642-32963664 AAATTTTCCATGAAAGAGCTAGG + Intronic
1167189985 19:47979723-47979745 ATGTTTTCCATCCAAGAACATGG + Intronic
925028705 2:631924-631946 CAGTTTCACATCAAAGACCTGGG + Intergenic
925323740 2:2998924-2998946 CAATTTTCTATCAGAGTGCAAGG + Intergenic
925386203 2:3463514-3463536 TAACTTCCCATCAAAGAGCATGG + Intronic
927432915 2:23042029-23042051 CAGCTTTCCTTCAAAGTTCAGGG + Intergenic
928094766 2:28397502-28397524 CACTTTTTCATCAAAGGGAATGG + Intronic
928741528 2:34359511-34359533 CAATTTTCCAGAAAAGTGCAAGG - Intergenic
929760987 2:44806028-44806050 CAGTTTTCAATAACAAAGCAGGG - Intergenic
930205432 2:48583005-48583027 CAGTCTTATTTCAAAGAGCAGGG - Intronic
931484877 2:62680579-62680601 CAGTTTTGCATAAAACAGGAGGG + Intronic
931947435 2:67325606-67325628 CTGTTTTACAGAAAAGAGCATGG - Intergenic
931963023 2:67502823-67502845 CAGTTTACTCCCAAAGAGCACGG - Intergenic
935578576 2:104736092-104736114 CTCTCTTCCATCACAGAGCAGGG - Intergenic
936021990 2:109002059-109002081 CTATTTTCCATCCAAGAGTAGGG + Intergenic
938819428 2:134940222-134940244 CAGTTGACCCTCAAACAGCACGG + Intronic
938888832 2:135681919-135681941 CAGTTTTGCATCAAAGGGGCTGG - Intronic
939566089 2:143788166-143788188 CAGCTTTCCATCAAAGATGCTGG + Intergenic
941255395 2:163224100-163224122 AAGTTCTCAATGAAAGAGCATGG - Intergenic
943178613 2:184511855-184511877 GAGATTTCAATCAAAGAGCAAGG - Intergenic
943862317 2:192883261-192883283 CAGCTTTAGATCAAAGAGGAAGG - Intergenic
946204920 2:218097816-218097838 AATTTTTCCATCCATGAGCATGG + Intergenic
946766310 2:223044340-223044362 CAGATTTTCATCACAGGGCAGGG - Intergenic
948534306 2:238634786-238634808 CAGATTTGCATCATAGAGCTTGG + Intergenic
948606925 2:239141652-239141674 CAGCTTGACATCAGAGAGCAGGG - Intronic
1170253881 20:14318111-14318133 CAATGTTCCATTAAAAAGCATGG - Intronic
1171027320 20:21642591-21642613 CAGCTTTCCAACACTGAGCATGG + Intergenic
1171514682 20:25719939-25719961 CAGTTTTCCTTCTAAGAGTCAGG + Intergenic
1174672977 20:52325072-52325094 GAGTTTTCCATGCAAGAGGAGGG + Intergenic
1174730067 20:52907419-52907441 CAGTCTTACATCAAAGCTCAGGG - Intergenic
1175861863 20:62154711-62154733 CAGTTTGCCAAAAAAGACCAGGG - Intronic
1176283012 20:64325813-64325835 CAGTTTTCCCTCAATGCCCAAGG - Intergenic
1176994770 21:15542808-15542830 CAGTTTTCCAACAAACTGCATGG - Intergenic
1177228136 21:18284164-18284186 CATCTTTCCTTCAAAGAGAAAGG + Intronic
1177872251 21:26588156-26588178 CAATTTTCCTTTAAAGAGCGAGG - Intergenic
1177880838 21:26692590-26692612 CATTCCTCCATCAAAGAACAAGG + Intergenic
1178804464 21:35826836-35826858 GAGTTTGGCATCACAGAGCATGG - Intronic
1178989378 21:37339903-37339925 GAGTTTTCCATCCAAAAGCTAGG + Intergenic
1179499322 21:41797148-41797170 CAGTTTTCCACCACACTGCATGG + Intergenic
1179579617 21:42332894-42332916 CAGTTTTCCAGCAAATGGCATGG + Intergenic
1182248114 22:28976698-28976720 CAGTTTTACTTCAAATTGCAAGG - Intronic
1182384860 22:29929357-29929379 CTGTTTTCCATCAAAAAGATTGG - Intronic
1183820671 22:40343675-40343697 GAGTTTGCCATCAATGAGCAAGG + Intergenic
1184851227 22:47122380-47122402 CAGTGTCCCATCACAGAGGAGGG + Intronic
949765921 3:7525494-7525516 CAGGTATCCATCACAGAGCCTGG + Intronic
951683716 3:25321780-25321802 GAGCTTTCTACCAAAGAGCAAGG - Intronic
951981286 3:28569709-28569731 CATTTTTCAATCAAAGAAAAGGG + Intergenic
952698669 3:36302325-36302347 CAGCATCCCAGCAAAGAGCATGG + Intergenic
953077876 3:39587457-39587479 AAGTTATCCATCAAGGAACAAGG - Intergenic
954315115 3:49796968-49796990 CCTTTCTCCATCAATGAGCAAGG - Exonic
957331620 3:78771510-78771532 GAGTCTTCAATCAATGAGCATGG + Intronic
957418539 3:79937731-79937753 CATTCTTCCATGAAAGAGCTTGG + Intergenic
958901786 3:99895716-99895738 AGGTTTTCCATCAAAGATGAAGG - Intronic
959934248 3:112013103-112013125 CAGAATTCCAGCAAAGAGTAGGG - Intronic
960237245 3:115298017-115298039 CAATTTTCCATTAAATAGCGGGG + Intergenic
960727914 3:120689679-120689701 CATTTTTCCATTAAAGGGTAAGG + Exonic
960768752 3:121168090-121168112 CAGTTTTCCTTCTAAGAGTCAGG - Intronic
962617741 3:137144485-137144507 CAGTTTCCCATCCATGAACAAGG + Intergenic
962838127 3:139206559-139206581 CAGTTTTCCTCACAAGAGCAAGG + Intronic
965174467 3:165313880-165313902 TAGTTTTCAATAAAAGAGAAAGG - Intergenic
967155753 3:186690417-186690439 CAGTTTTCTATCATAGTGCAAGG - Intergenic
967157036 3:186702576-186702598 CAGTTTTCTATCATAGTGCAAGG - Intergenic
968023980 3:195422977-195422999 CAGTATTCCATCAAGGTTCATGG - Intronic
968827751 4:2912041-2912063 CAGATTTTCATCTACGAGCAGGG - Intronic
971228477 4:24777520-24777542 GAGCTTTCCATCAAAGAGTCAGG - Intergenic
972716959 4:41656036-41656058 CAATTTTCCCTCATTGAGCAAGG + Intronic
973229350 4:47824042-47824064 CAGTTGTTCACCAAGGAGCAAGG + Intronic
975034271 4:69661364-69661386 CAGTCTGACATCAAAGTGCAAGG - Intergenic
976799800 4:88976174-88976196 CAGTTATTCATTAAAGAGAAAGG - Intronic
977778698 4:100954787-100954809 CAGTTTTCCTTTAAATAGAAGGG - Intergenic
978195027 4:105961620-105961642 CATTTTTCCATCAGAGAGAAAGG - Intronic
978306509 4:107334315-107334337 CAGTTTTACAAAAAAGAGAAGGG + Intergenic
980066066 4:128190161-128190183 AAGTTTTCCTTCAAACAGGAAGG - Intronic
981096501 4:140787913-140787935 TAGTTTTCCTTCAAACAGAAAGG + Intergenic
984671565 4:182495034-182495056 CAGGTTTCCTTCAATGAGCCAGG - Intronic
985000876 4:185481195-185481217 CAGTTTGGCATCAAAAAGAAAGG - Intergenic
985728626 5:1529720-1529742 GAGTTATCCATCCATGAGCATGG + Intergenic
986172831 5:5327579-5327601 CAGTTTCCCAAGAGAGAGCAGGG - Intergenic
987804454 5:22745221-22745243 AAGTTTTCAATCAAAGAGTTAGG + Intronic
989214238 5:38887671-38887693 CAGTTTTACATAAAAGAGTATGG - Intronic
989336055 5:40318155-40318177 CAGTTTGCCATCAACTAACATGG - Intergenic
991160879 5:63500858-63500880 AAGTTTTCCTTCAAAGCACAAGG + Intergenic
992497201 5:77305541-77305563 GAGTTTCCCAGCATAGAGCAGGG + Intronic
994206965 5:97046121-97046143 CACTCTTCCATAAAAAAGCAAGG + Intergenic
994802385 5:104395676-104395698 CAGTTTTCCATCTAAAAGTCAGG - Intergenic
996239896 5:121184645-121184667 CAATTTTCTACCAAAGACCAGGG + Intergenic
997276626 5:132598351-132598373 CAGTTTCCCCTCTAAGAGTAAGG + Intronic
997751217 5:136347690-136347712 CAATTTTCCATCAAAGATCAAGG + Intronic
1004323384 6:14651294-14651316 CAGTTTGCCATTTAAGAGCTGGG - Intergenic
1004640158 6:17507288-17507310 CAGCTATCCATCCAAGGGCAGGG - Exonic
1007375827 6:41456102-41456124 CAGTTTTGAAACAAAGACCATGG - Intergenic
1008283483 6:49622805-49622827 TGGTTTTCCATCAAAGGGGAAGG - Intronic
1008922045 6:56852175-56852197 CAGGTTCCCAGAAAAGAGCAAGG + Intronic
1009555339 6:65156840-65156862 CAGTTTCTCATCAAAGATAATGG + Intronic
1010290735 6:74133525-74133547 AATTTTTCCATCAAAGGGCGTGG - Intergenic
1010340403 6:74744331-74744353 TAGTTTACCATCAAACAACATGG + Intergenic
1010949823 6:82022564-82022586 CAGTGTCCCAGCATAGAGCAGGG + Intergenic
1014142662 6:117962506-117962528 CGGTTTTACATCAAAGAAGACGG - Intronic
1014654986 6:124091507-124091529 TGATTTTCCATCAAAGACCAGGG + Intronic
1016516326 6:144896414-144896436 CACTGTTCCATCAATGAGGATGG + Intergenic
1016553892 6:145313714-145313736 CAGTCTTCCACCCAAGAGCTAGG + Intergenic
1019007512 6:168812794-168812816 CAGTTTTAAAGTAAAGAGCAAGG - Intergenic
1022110567 7:27228155-27228177 CAGTTTTCCACCTAAAAGCCTGG + Intergenic
1023240088 7:38135016-38135038 CAGATTTCCATCAGAAACCATGG + Intergenic
1023514557 7:40988071-40988093 CAATTCTCCCCCAAAGAGCATGG + Intergenic
1024214452 7:47235584-47235606 CAGTTGACCTTCAAACAGCATGG - Intergenic
1026548639 7:71347575-71347597 AAGTTTTCCATGTAAGTGCAAGG - Intronic
1026918047 7:74134473-74134495 GAGTTTTCCAGGAAAGGGCAGGG - Intergenic
1026940443 7:74284814-74284836 CAGCTTTCCTTCACACAGCAGGG + Intergenic
1027545138 7:79518170-79518192 AAGTTTGCCACCTAAGAGCATGG + Intergenic
1027837021 7:83257211-83257233 CAGTTTACCCTCAAACAGCGTGG - Intergenic
1030608488 7:111663820-111663842 CAGTTTTCAATAAAATAGAAAGG - Intergenic
1032346646 7:131122628-131122650 CAGTTTCCCATGAGAGAGAAAGG + Intronic
1032675194 7:134123793-134123815 CAGTGTTCCATAAAAAATCACGG + Intergenic
1032879080 7:136069406-136069428 CAATTTTCCCTCAAACAGCAGGG - Intergenic
1036215903 8:6879574-6879596 CAGTTTTCCATTTACCAGCAGGG - Intergenic
1037764276 8:21762325-21762347 CAGTTGTCAATCAAAGCCCAAGG + Intronic
1039126738 8:34211785-34211807 CAGTTTTCCTTCCAGGAGCATGG + Intergenic
1040010928 8:42660457-42660479 CAATTTTCCATTCAAGGGCAAGG + Intergenic
1040708159 8:50154132-50154154 CAGTCTGACATCAAAGTGCAAGG - Intronic
1040942936 8:52851902-52851924 CAGTTTTCCTTCTAACAGTAAGG + Intergenic
1042275558 8:67001646-67001668 CAGGTTACTATCAAATAGCATGG + Intronic
1042843861 8:73150643-73150665 CAGCTGTCAATCACAGAGCAGGG - Intergenic
1042958310 8:74275775-74275797 CAGTTTTTCTTCACAGAACAAGG + Intronic
1043257362 8:78152746-78152768 CAATTTTCTATTAAAGAACATGG + Intergenic
1043351631 8:79368215-79368237 CATTTTTCCAACAAAGAAAATGG - Intergenic
1048279281 8:133093189-133093211 TATTTTTCCAACAATGAGCAGGG - Intronic
1048779048 8:137981111-137981133 GAGGTGTGCATCAAAGAGCAGGG - Intergenic
1048988107 8:139746196-139746218 GAGTATTCCATGAGAGAGCAGGG - Intronic
1051213220 9:14767663-14767685 CAATTTTCCAGTAAAAAGCAAGG - Intronic
1056006300 9:82275135-82275157 CAGTTTTTCATTAAATCGCAGGG + Intergenic
1188653388 X:32659736-32659758 CATCTTTCCATGACAGAGCAGGG + Intronic
1191008545 X:55737532-55737554 CAGTTTTTCACCACTGAGCATGG + Intronic
1192202759 X:69077509-69077531 CAATTTTCCATATAAGATCAGGG + Intergenic
1197401872 X:126002839-126002861 CAGTATTCAATCAAACAGAAGGG + Intergenic
1198372662 X:136006184-136006206 CAGCTTTGCATCAAAGGGGAGGG + Intronic
1201068828 Y:10125939-10125961 CAGTTTTCCATCACAGGGATTGG + Intergenic
1201938771 Y:19435756-19435778 TAGTTTTCCTTCTAAGAGCCAGG - Intergenic
1202168170 Y:22014378-22014400 CTGTTTAACACCAAAGAGCATGG + Intergenic
1202223191 Y:22571990-22572012 CTGTTTAACACCAAAGAGCATGG - Intergenic
1202319924 Y:23623670-23623692 CTGTTTAACACCAAAGAGCATGG + Intergenic
1202550844 Y:26046386-26046408 CTGTTTAACACCAAAGAGCATGG - Intergenic