ID: 924101893

View in Genome Browser
Species Human (GRCh38)
Location 1:240612120-240612142
Sequence CGGGCTCCTTTCACATCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924101893_924101898 12 Left 924101893 1:240612120-240612142 CCTGCAGATGTGAAAGGAGCCCG 0: 1
1: 0
2: 1
3: 7
4: 126
Right 924101898 1:240612155-240612177 TGAATCCTCTCGGCGCTGCATGG 0: 1
1: 0
2: 0
3: 2
4: 42
924101893_924101897 2 Left 924101893 1:240612120-240612142 CCTGCAGATGTGAAAGGAGCCCG 0: 1
1: 0
2: 1
3: 7
4: 126
Right 924101897 1:240612145-240612167 GACTTAGCTCTGAATCCTCTCGG 0: 1
1: 0
2: 0
3: 8
4: 135
924101893_924101900 14 Left 924101893 1:240612120-240612142 CCTGCAGATGTGAAAGGAGCCCG 0: 1
1: 0
2: 1
3: 7
4: 126
Right 924101900 1:240612157-240612179 AATCCTCTCGGCGCTGCATGGGG 0: 1
1: 0
2: 0
3: 3
4: 35
924101893_924101899 13 Left 924101893 1:240612120-240612142 CCTGCAGATGTGAAAGGAGCCCG 0: 1
1: 0
2: 1
3: 7
4: 126
Right 924101899 1:240612156-240612178 GAATCCTCTCGGCGCTGCATGGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924101893 Original CRISPR CGGGCTCCTTTCACATCTGC AGG (reversed) Exonic
900749603 1:4386893-4386915 CAGGCTCCTTTCCCAGCTGCTGG + Intergenic
902301893 1:15507779-15507801 TGGGCTCCTGACACACCTGCAGG + Intronic
903897966 1:26621074-26621096 CGGGCTCCTGTCTCCTCGGCCGG - Intergenic
908928784 1:69290371-69290393 CTGACTCCTTTCACTTCAGCTGG - Intergenic
909917122 1:81333988-81334010 CTGGTACCTTTCAAATCTGCTGG + Intronic
910205189 1:84742609-84742631 AGGGCTGCTTTCCCTTCTGCGGG - Intergenic
910867128 1:91798897-91798919 CAGCCTCCTTTCACATTGGCTGG + Intronic
911256579 1:95639952-95639974 AGGGCTCCTCTCACATTTTCTGG + Intergenic
913471912 1:119196648-119196670 CTGGCTCCTTCCACATCTGCAGG + Intergenic
913617197 1:120572820-120572842 TGGGCTCTTTTCTCATCTGGAGG - Intergenic
914573079 1:148938094-148938116 TGGGCTCTTTTCTCATCTGGAGG + Intronic
915736720 1:158089875-158089897 CAGCCTCCTCTCACTTCTGCTGG + Intronic
924101893 1:240612120-240612142 CGGGCTCCTTTCACATCTGCAGG - Exonic
1064243180 10:13648677-13648699 CGGGCTCCAGTGACATCGGCTGG + Intronic
1066652672 10:37673174-37673196 GGAGATCCTTTCACATGTGCGGG - Intergenic
1067036429 10:42923317-42923339 AGAGATCCTTTCACATGTGCAGG - Intergenic
1067197285 10:44132982-44133004 CTGGCTGATTTCACATCTGAGGG + Intergenic
1067453707 10:46398103-46398125 CGGGCTGTGTTCACATCGGCTGG + Intergenic
1067583520 10:47461643-47461665 CGGGCTGTGTTCACATCGGCTGG - Intronic
1067633524 10:47986991-47987013 CGGGCTGTGTTCACATCAGCTGG - Intergenic
1068526294 10:58134093-58134115 CTGGCTCCTCTCTCCTCTGCAGG - Intergenic
1069443410 10:68450288-68450310 TTAGCTCATTTCACATCTGCTGG + Intronic
1072773715 10:98167377-98167399 CAGGCACATTTCACACCTGCTGG + Intronic
1072959101 10:99913544-99913566 CCAGCTCCTTTAACACCTGCCGG - Intronic
1073051013 10:100667524-100667546 CGGGCTCCTTTCCCCACTGATGG + Intergenic
1075086747 10:119418860-119418882 CTGGCTGCCTTCACCTCTGCAGG + Intronic
1076420869 10:130330792-130330814 CTGGCTCCTTACACAGCTGCTGG + Intergenic
1077525700 11:3063263-3063285 CTGGCTGCTTTCACAGCAGCTGG - Intergenic
1079404199 11:20130757-20130779 GGGACTCATTTCCCATCTGCGGG + Intergenic
1082972357 11:59037059-59037081 TGGGCTCCTCTCCCATCTGTAGG - Intronic
1082976830 11:59080943-59080965 AGGGCTCCTCTCCCATCTGTAGG - Intergenic
1083257948 11:61508280-61508302 CCGGCCCTTTTCACATCTGCTGG - Intergenic
1087168567 11:95027413-95027435 TGGGCTCCTGACTCATCTGCTGG + Exonic
1088367886 11:109058169-109058191 CAGACTCCATTCACATCTGAGGG - Intergenic
1089276757 11:117341846-117341868 CTGCCTCCTTTCACTTATGCAGG + Intronic
1089830524 11:121323593-121323615 TGGGCTCCTTACACACCTGTGGG - Intergenic
1090719524 11:129458981-129459003 CAGGCTCCTTTCATGCCTGCCGG + Intergenic
1092749697 12:11707284-11707306 CGGGCTCATTTCCCATGAGCAGG + Intronic
1095568207 12:43650948-43650970 AGGGCTTATTTCCCATCTGCTGG + Intergenic
1098362001 12:69663867-69663889 CGGAATCCTTTCTAATCTGCTGG - Intronic
1103362428 12:120361922-120361944 CGGCCTCCAATCACAGCTGCTGG + Intronic
1104749874 12:131231659-131231681 CGGGGCCCATTCACCTCTGCTGG - Intergenic
1106160092 13:27193705-27193727 CGGGCACCTTTCAGTGCTGCTGG - Intergenic
1107765889 13:43734114-43734136 CATGCTCCTTTGACATCTGTAGG - Intronic
1112091604 13:96090095-96090117 AGGGCTCCTGTCACACCGGCTGG + Intergenic
1116662255 14:47725882-47725904 TGCACTCCTTTCACAACTGCTGG - Intergenic
1118908859 14:70044728-70044750 GGGGCTCCCTTCACCTCTCCTGG - Exonic
1120680488 14:87475329-87475351 CTTGCTCCTATGACATCTGCTGG - Intergenic
1121239634 14:92419509-92419531 TGGGCTACTTTGACATCTCCTGG + Intronic
1121559813 14:94866072-94866094 CAGTCGCCTTTCACATCTGGAGG + Intergenic
1122400442 14:101464387-101464409 TCGGCTCCTTCCACGTCTGCTGG - Intergenic
1126373011 15:47966681-47966703 CAGGCTTCATTCACAACTGCAGG + Intergenic
1132571175 16:644816-644838 CGGGGTCCCTGCACATCTCCTGG + Intronic
1132941978 16:2513016-2513038 TGGGCTGCTTTCACGGCTGCGGG + Intronic
1133730832 16:8577257-8577279 CAGACACCTTTCACAGCTGCAGG - Intronic
1139372017 16:66474848-66474870 CTGTCTCCTGTCACTTCTGCAGG + Intronic
1140649287 16:77069082-77069104 AGGGCTCCTCTCACATTTACAGG - Intergenic
1141603355 16:85139337-85139359 GGGGCTCCTTTCACCTGGGCTGG + Intergenic
1149863317 17:60136517-60136539 CTGGCTCCTTTCAGATCTGTGGG - Intergenic
1151390455 17:73783678-73783700 AGGGCTCCTTCCTCCTCTGCAGG - Intergenic
1151419445 17:73987580-73987602 TGGGCTCCTTTCTCATTTCCTGG - Intergenic
1151675441 17:75595102-75595124 AGGGCTCCTTCTGCATCTGCTGG + Intergenic
1151698720 17:75731337-75731359 CTGGGTCCTTTCACATCCGGCGG + Exonic
1154968533 18:21383654-21383676 CAGCATCCTTTCTCATCTGCAGG + Exonic
1155076152 18:22357272-22357294 CAGGCTCTTTTCACTTTTGCCGG - Intergenic
1159272054 18:66165576-66165598 TGGGCTTCTTTCACTTCTGAGGG - Intergenic
1161560961 19:4972162-4972184 TGGGCTCCGTTCTCATCTGGTGG + Intronic
1164739234 19:30564434-30564456 CAGGATCCTTTCATTTCTGCTGG - Intronic
1167059421 19:47134369-47134391 CAGGCTCATTTCAGATCTGTGGG + Intronic
1168288541 19:55346219-55346241 CAGGCTGCGTTCCCATCTGCAGG - Exonic
925278512 2:2667266-2667288 TGGGCTCCTGTCCCATCTGGAGG - Intergenic
926681188 2:15665277-15665299 CGGGCCCCACTCACCTCTGCTGG - Intergenic
927875710 2:26653926-26653948 CGGGCTTCTTTTTCTTCTGCAGG + Intergenic
927884995 2:26712893-26712915 AAGCCTCCTTTCACATCTCCTGG + Intronic
936040420 2:109145480-109145502 CCGCCTCCTTTCTCATCTGTGGG + Intronic
937017685 2:118620601-118620623 AGGCCTCCTTTCACATGCGCAGG - Intergenic
942500134 2:176580554-176580576 TGGGCTCCATTCACACCTGTAGG - Intergenic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
947548928 2:231032734-231032756 GGGCCTCCTTTCAAATCTACTGG - Intergenic
1171182015 20:23098005-23098027 CGGCCTCCTCTGACCTCTGCAGG + Intergenic
1172280251 20:33702963-33702985 GGGACTCCTCTCAGATCTGCTGG + Exonic
1173593920 20:44247081-44247103 CGGGCTCCTTCCACCCTTGCAGG + Intronic
1180193928 21:46182497-46182519 CGGGCACCTTTCACACCCTCAGG - Intronic
1182090765 22:27593097-27593119 CAGGCCCCCCTCACATCTGCAGG + Intergenic
1182978205 22:34643142-34643164 CTGGCTCCCTCCACATCTGCTGG - Intergenic
1183971220 22:41478975-41478997 CGGGCTCCTTGACCTTCTGCAGG + Intronic
1184991440 22:48172790-48172812 CAGCCCCCTTTGACATCTGCAGG - Intergenic
1185292745 22:50035339-50035361 GGGGTTCCATTCACACCTGCTGG + Intronic
955790723 3:62586318-62586340 TGGGCTTCTTTCACCTCTGGAGG + Intronic
958958960 3:100491239-100491261 CGGGCTGCATTGTCATCTGCAGG - Intergenic
962362962 3:134756829-134756851 GGGGCACCTGTCACATCTGAAGG + Intronic
967833422 3:193941666-193941688 AAGGCTCCCTTCACATCTCCTGG - Intergenic
969523448 4:7692177-7692199 TGGGCTGGCTTCACATCTGCTGG + Intronic
977277255 4:94992984-94993006 AGGGATCCTCTCACATCAGCTGG + Intronic
985331868 4:188846072-188846094 CGGGCTGCTTCCACTTATGCTGG - Intergenic
985500301 5:239656-239678 CGGCCACCCTTCACATCAGCGGG - Intronic
986829161 5:11557333-11557355 AGGGCTACTTTCTCTTCTGCAGG + Intronic
987287675 5:16474752-16474774 AGGTTTCCTTTCAAATCTGCTGG - Exonic
994037313 5:95216592-95216614 CGGACACCTTTGACATCTGGTGG - Intronic
999197354 5:149791492-149791514 GGAGCTCCTTGCACACCTGCAGG - Intronic
1002121177 5:177006172-177006194 CGGGTCCCTTTCACACCTGGGGG - Intronic
1003550473 6:7098388-7098410 CTGCCTCCTTCCACATCTTCAGG + Intergenic
1008671009 6:53768813-53768835 TGGGCTCATTAAACATCTGCAGG - Intergenic
1010678354 6:78769953-78769975 CTGCCTCCTGTCACATCAGCTGG + Intergenic
1013835843 6:114334227-114334249 AGGGGACCTTTCAGATCTGCAGG + Intronic
1017440789 6:154462708-154462730 TCAGCTCCCTTCACATCTGCAGG + Intronic
1018455889 6:163951842-163951864 CGTGCTCCTTTCCCAGGTGCTGG - Intergenic
1019506597 7:1394571-1394593 TGGGCTGCATTCTCATCTGCAGG + Intergenic
1023192859 7:37601482-37601504 TGGGCTTCTTTTACAGCTGCTGG + Intergenic
1024011621 7:45271720-45271742 CAGGCTCCACTCACATCTGCAGG - Intergenic
1025050050 7:55726202-55726224 CGGCCTCCTGTCAGATCAGCAGG - Intergenic
1025981628 7:66411940-66411962 TGTTCTCCTTTCACATCTTCAGG - Intronic
1026040365 7:66863358-66863380 CGTTCTCCTTTCACGTCTTCAGG + Intergenic
1026799904 7:73393520-73393542 AGAGCTCCTTTCAGCTCTGCGGG - Intergenic
1027211791 7:76155308-76155330 CATTCTCCTTTCACATCTTCAGG - Intergenic
1029232060 7:99078629-99078651 CCGCCTCCTGTCACATCAGCCGG + Intronic
1030324291 7:108203598-108203620 CTGTCTCCTTTCGCCTCTGCAGG - Intronic
1034253664 7:149713306-149713328 CTGCCTCCTGTCAGATCTGCAGG + Intergenic
1035865101 8:3074038-3074060 CGGGCTGCTTTCTCACCTGGAGG + Intronic
1037329475 8:17730178-17730200 CGGCCTGCTTTCACATCTTTTGG - Intronic
1038720340 8:30029257-30029279 CGGGATTCTTTCACATTTGGTGG + Intergenic
1046551750 8:115727038-115727060 CCTGCTCCTTTCATATTTGCAGG + Intronic
1049105156 8:140608274-140608296 CGGTCTCCTGTCACATCCCCAGG + Intronic
1053283448 9:36836154-36836176 TGGGCACCTTTCACATGTGCAGG - Exonic
1055446035 9:76383162-76383184 CCGCCTCCTGTCACATCAGCGGG - Intergenic
1056185076 9:84126383-84126405 CGGGTTACATTCTCATCTGCAGG - Intergenic
1056927525 9:90847548-90847570 CGTGCTCCCTCCACACCTGCAGG + Intronic
1061058853 9:128240265-128240287 GGTGCTCCTTAAACATCTGCTGG + Intronic
1062130656 9:134891368-134891390 CGGGCTCCTTTCTCATCCTAAGG - Intergenic
1062250801 9:135592600-135592622 GGGGCTCCTCTCACATAAGCAGG + Intergenic
1191655033 X:63586735-63586757 TGGGCTCCATCCACATCAGCTGG + Intergenic
1191683887 X:63869371-63869393 CTGGCTCCTTTGTCATCTGTGGG - Intergenic
1195974912 X:110516195-110516217 CTGGCTGCTTTCAATTCTGCAGG + Intergenic
1198331280 X:135625329-135625351 CTGGCTCCTAACACATCTCCAGG - Intergenic
1199527002 X:148803922-148803944 CAGGCTGCTTTTCCATCTGCTGG - Intronic