ID: 924102241

View in Genome Browser
Species Human (GRCh38)
Location 1:240616847-240616869
Sequence ATGAGTCACCACATCTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924102241_924102243 -1 Left 924102241 1:240616847-240616869 CCAAGCCAGATGTGGTGACTCAT No data
Right 924102243 1:240616869-240616891 TGTCTGTAATCCCAGCACTTTGG 0: 4124
1: 101521
2: 240356
3: 245391
4: 213829
924102241_924102251 25 Left 924102241 1:240616847-240616869 CCAAGCCAGATGTGGTGACTCAT No data
Right 924102251 1:240616895-240616917 GCCAAGGCGGATGGATCACAAGG 0: 39
1: 1264
2: 8483
3: 28230
4: 58813
924102241_924102247 9 Left 924102241 1:240616847-240616869 CCAAGCCAGATGTGGTGACTCAT No data
Right 924102247 1:240616879-240616901 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
924102241_924102250 16 Left 924102241 1:240616847-240616869 CCAAGCCAGATGTGGTGACTCAT No data
Right 924102250 1:240616886-240616908 CTTTGGGAGGCCAAGGCGGATGG 0: 711
1: 22335
2: 112806
3: 168357
4: 160463
924102241_924102245 3 Left 924102241 1:240616847-240616869 CCAAGCCAGATGTGGTGACTCAT No data
Right 924102245 1:240616873-240616895 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
924102241_924102244 0 Left 924102241 1:240616847-240616869 CCAAGCCAGATGTGGTGACTCAT No data
Right 924102244 1:240616870-240616892 GTCTGTAATCCCAGCACTTTGGG 0: 8926
1: 233921
2: 277195
3: 180913
4: 143944
924102241_924102249 12 Left 924102241 1:240616847-240616869 CCAAGCCAGATGTGGTGACTCAT No data
Right 924102249 1:240616882-240616904 AGCACTTTGGGAGGCCAAGGCGG 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924102241 Original CRISPR ATGAGTCACCACATCTGGCT TGG (reversed) Intergenic
No off target data available for this crispr