ID: 924110562

View in Genome Browser
Species Human (GRCh38)
Location 1:240695501-240695523
Sequence CACCCTAAGAGTTTCATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924110562_924110567 8 Left 924110562 1:240695501-240695523 CCATTCATGAAACTCTTAGGGTG No data
Right 924110567 1:240695532-240695554 CCTCACTTGGCCACTGCCATTGG No data
924110562_924110563 -5 Left 924110562 1:240695501-240695523 CCATTCATGAAACTCTTAGGGTG No data
Right 924110563 1:240695519-240695541 GGGTGATGACACCCCTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924110562 Original CRISPR CACCCTAAGAGTTTCATGAA TGG (reversed) Intergenic
No off target data available for this crispr