ID: 924110563

View in Genome Browser
Species Human (GRCh38)
Location 1:240695519-240695541
Sequence GGGTGATGACACCCCTCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924110562_924110563 -5 Left 924110562 1:240695501-240695523 CCATTCATGAAACTCTTAGGGTG No data
Right 924110563 1:240695519-240695541 GGGTGATGACACCCCTCACTTGG No data
924110559_924110563 27 Left 924110559 1:240695469-240695491 CCATAAATCAGCGTGGAGTTATA No data
Right 924110563 1:240695519-240695541 GGGTGATGACACCCCTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924110563 Original CRISPR GGGTGATGACACCCCTCACT TGG Intergenic
No off target data available for this crispr