ID: 924110567

View in Genome Browser
Species Human (GRCh38)
Location 1:240695532-240695554
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924110562_924110567 8 Left 924110562 1:240695501-240695523 CCATTCATGAAACTCTTAGGGTG No data
Right 924110567 1:240695532-240695554 CCTCACTTGGCCACTGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type