ID: 924113269

View in Genome Browser
Species Human (GRCh38)
Location 1:240721369-240721391
Sequence GGCTGACATCAACTCCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924113269_924113270 -6 Left 924113269 1:240721369-240721391 CCTTTAAGGAGTTGATGTCAGCC No data
Right 924113270 1:240721386-240721408 TCAGCCAGTTTAGTTTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924113269 Original CRISPR GGCTGACATCAACTCCTTAA AGG (reversed) Intergenic
No off target data available for this crispr